SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15663
Annotation
PREDICTED:_uncharacterized_protein_LOC105388498_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 4.097
 

Sequence

CDS
ATGGACAAACTTGAACTTCAATCAACTTGTTTCGAGAATATCAAGACTTTGTGTACAAACTACCGCAAAGATTCTTCGTCTCGAAAAACTGAAGAGTACCTCAACATACGTTTGTCATCTTTGGAAGAACAGTGGAGAGACTTCGAGGCGAGAAATGCCTTATTACTACTGGAACTGGAAGACAAAACTATACATTATTTCTCTGAAGACGTTTACAACAAAACTAAAGAAATGTATCTAGCAACAAAAACAGACTTAAACAACAGACTTAAATACTTGAAACAGCAAAAACATAGTGTGAATTTTGATTTAAGTGACATTTCTATTGACTACACTCAAGACTGCGAGGACGGAAAATCTGAAAAAATACAACAACTTTTAAATAAACAAGAATGCAATTTTAATGCGATTTGTCATGCATTGTCTAAAATTGACATCATTAGAACTAGTGAAAAGTGGGAGCTGGAAGATAATTTTAACATTTTAAAATCGAAGTGGGAGTCCATCGACAAACTGCACTGGGAAATTGACTTTCAGCTGAAGGGGTCTAACGATCACTATTACCGGATGTACTCAGATATAGAAGAAAAATATGATGAATTGAGAAAACAACTTCAATCTAAAATTTGGTCGAATGCACACTATCAGCAGTCGACACCGAGAATGGAATTACCTGATTTTTACGGAAACTACAGTAAGTGGATCTCTTTTAAGGACCTGTTTCTCGAAACCATCCATAACAACCCAACAATTAACAAAGCGCAAAAAATGAAACACCTGAAAACCAAATTGAAGGGGGAAGCAGAAAGTCTGGTACAGCATTTATCCGTCTGTGCTGAAAACTACAACTCCTGCTGGGATATTTTAGTGCAACGGTATGATAATCGTCGTCTACAATTTTCATCGTTTTTCAACACAATGATGAGTCTCCCTGTTATACATCAACCCGACGCTAACAATCTCAAGAAAATGCATGACGTCATTAAGGAATGCATGAACGGCATAGCTAACATCGGGCTGGATACGGCAACGTGGGATCCAATGATCGTGCATTTAATGTTACCAAAATTAGATTCAACAACTTTAAATGATTATATGAACGACATCCGAGATCACAGAGAATTACAAAACTTGCAAGATTTTTTATATTTTTTGGAGTGCAAGTTTATGGCATATGAAACTGCAAAATCAACAAAATCTGTAAAAAATACCACTTCCGAAAAAACATCTCATTGGAAACCGGCTAACAACAAACAACCTGTAAAAAATTTTACATATGACTCTAAGAAAACTTATAACTATCACGCTACTTATGGAAAATGCCCGAATTGTAATGGAAATCATGTTTTAATGCAATGTGCTAAATTTATTAACATGGATACTGCACAGCGAAACCACACTGTTGCGAAATTGAAACTCTGCAAAAATTGTCTCTATAGCCACAATAACGAAGAATGTAAATCAGCGAAAACGTGTAAGGAGTGTAACATGAAACATCATACCATGTTGCACAACGTGAACTGGAAAATTCCAGCGAATGGTAAAAATAACTTTGGACAACAAGCCTCCTCTTCTCAGCAACAAGCTTCGAATCACTTATCATCGGATAAAACTGAAATTTTACTAACTACAACTCTACTGAAAATAAAGGCTTATGATGGCACTTATGTAAAACTTAGGGCCCTCTTGGATCAGGGCTCGCAAGTAAACTTAATAACAGAAAATGCTGCTCAGGTATTACGCCTGCCGAGGAAAAGGTTCGCTGCTACCATCTCAGGGGTTGGTTCAGTATCTGGTGATTGCAGGGGTCAACTAAACTTATCTTGTAAATCAATAAACTCTGAATACGACTTCGAAATACAAGCACTTATAATGAAAAAACTTACAAATAACTTACCGAATGCTACTTTCGAAAAATCGAACTGGCCTCATTTGGAAAACTTAAAGCTGGCTGATCCTGACTTCAACATCTCTCGCCCCATCGACTTACTACTGGGTGCCGATGTTTATTCAGATATTATACTCAATGGAGTTTTGAAAGGAAGCTGTCAATCCCCTGTGGCACAACAGACACATCTAGGATGGATCCTATGTGGGAAAATGAAAACGTTTAATTGCCACGTGACCTTGGTGAACTTTGATGAATTAACAAAGTACTGGGAGAGCGAAGAAATACAAAATTCTGAAGATATTTCCAAGGACGATCAGTGTGAACTATTTTATTCGGAAACAGTACAACGTGCTCCCGACGGAAAATATATTGTGAAGATGCCACTCCGCCCTGACCTTAAAGAAAAATTAGGATAA
Protein
MDKLELQSTCFENIKTLCTNYRKDSSSRKTEEYLNIRLSSLEEQWRDFEARNALLLLELEDKTIHYFSEDVYNKTKEMYLATKTDLNNRLKYLKQQKHSVNFDLSDISIDYTQDCEDGKSEKIQQLLNKQECNFNAICHALSKIDIIRTSEKWELEDNFNILKSKWESIDKLHWEIDFQLKGSNDHYYRMYSDIEEKYDELRKQLQSKIWSNAHYQQSTPRMELPDFYGNYSKWISFKDLFLETIHNNPTINKAQKMKHLKTKLKGEAESLVQHLSVCAENYNSCWDILVQRYDNRRLQFSSFFNTMMSLPVIHQPDANNLKKMHDVIKECMNGIANIGLDTATWDPMIVHLMLPKLDSTTLNDYMNDIRDHRELQNLQDFLYFLECKFMAYETAKSTKSVKNTTSEKTSHWKPANNKQPVKNFTYDSKKTYNYHATYGKCPNCNGNHVLMQCAKFINMDTAQRNHTVAKLKLCKNCLYSHNNEECKSAKTCKECNMKHHTMLHNVNWKIPANGKNNFGQQASSSQQQASNHLSSDKTEILLTTTLLKIKAYDGTYVKLRALLDQGSQVNLITENAAQVLRLPRKRFAATISGVGSVSGDCRGQLNLSCKSINSEYDFEIQALIMKKLTNNLPNATFEKSNWPHLENLKLADPDFNISRPIDLLLGADVYSDIILNGVLKGSCQSPVAQQTHLGWILCGKMKTFNCHVTLVNFDELTKYWESEEIQNSEDISKDDQCELFYSETVQRAPDGKYIVKMPLRPDLKEKLG

Summary

EMBL
KZ150641    PZC70422.1    KZ150005    PZC75227.1    JTDY01001118    KOB74820.1    + More
KZ149989    PZC75621.1    NWSH01000402    PCG76662.1    NWSH01000070    PCG79985.1    KZ150008    PZC75149.1    ODYU01005059    SOQ45565.1    ODYU01006730    SOQ48837.1    ODYU01012875    SOQ59395.1    JTDY01001277    KOB74321.1    LBMM01011051    KMQ87060.1    GEZM01060253    JAV71158.1    GEZM01060254    JAV71154.1    LBMM01017223    KMQ84153.1    LBMM01008464    KMQ88855.1    LBMM01009898    KMQ87805.1    LBMM01009746    KMQ87900.1    ODYU01008608    SOQ52337.1    LBMM01011516    KMQ86784.1    LBMM01015575    KMQ84755.1    KQ977080    KYN05933.1    LBMM01010417    KMQ87475.1    ODYU01008829    SOQ52773.1    KQ983160    KYQ46995.1    LBMM01009645    KMQ87967.1    LBMM01017818    KMQ83962.1    LBMM01012568    KMQ86144.1    LBMM01011492    KMQ86800.1    GAMC01020546    JAB86009.1    LBMM01006490    KMQ90572.1    KQ976954    KYN06860.1    LBMM01014829    KMQ85031.1    LBMM01004572    KMQ92278.1    KQ978058    KYM97736.1    KQ460036    KPJ18393.1    QOIP01000009    RLU19026.1    GAMC01003146    JAC03410.1    LBMM01010405    KMQ87487.1    QOIP01000012    RLU15613.1    JTDY01004853    KOB67675.1    KQ981619    KYN39239.1    LBMM01009284    KMQ88248.1    ABLF02028666    ABLF02066713    GFTR01008874    JAW07552.1    KQ977963    KYM98425.1    U11691    AAA19905.1    JTDY01001331    KOB74176.1    ABLF02022040    ABLF02056888    KQ982204    KYQ59009.1    QOIP01000003    RLU24798.1    LNIX01000026    OXA42254.1    GGMR01020322    MBY32941.1    GGMR01018506    MBY31125.1    KQ414692    KOC63601.1    KQ973442    KXZ75531.1    KQ978855    KYN27942.1    ABLF02016109    ABLF02016113    AY180917    AAN87269.1    GGMS01000724    MBY69927.1    GGMS01001896    MBY71099.1    GGMR01014413    MBY27032.1    KQ981002    KYN10407.1    LNIX01000036    OXA39969.1    KQ979016    KYN24380.1    AJWK01022907    LNIX01000044    OXA38660.1    LNIX01000001    OXA61293.1    LNIX01000007    OXA51382.1    GGMR01009911    MBY22530.1    LNIX01000018    OXA45284.1    LNIX01000003    OXA58579.1    LNIX01000063    OXA37200.1    AJWK01000239    AJWK01000240    KQ458793    KPJ04955.1    GGMS01005792    MBY74995.1    LBMM01009551    KMQ88039.1    LNIX01000002    OXA60848.1    KQ460545    KPJ14069.1   
Pfam
PF05585   DUF1758        + More
PF03564   DUF1759
PF17921   Integrase_H2C2
PF00230   MIP
PF12259   Baculo_F
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF00078   RVT_1
PF13843   DDE_Tnp_1_7
PF03175   DNA_pol_B_2
PF02145   Rap_GAP
Interpro
IPR005312   DUF1759        + More
IPR008737   Peptidase_asp_put       
IPR029060   PIN-like_dom_sf       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR000425   MIP       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR040676   DUF5641       
IPR023271   Aquaporin-like       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR022048   Envelope_fusion-like       
IPR000477   RT_dom       
IPR029526   PGBD       
IPR001878   Znf_CCHC       
IPR000727   T_SNARE_dom       
IPR001969   Aspartic_peptidase_AS       
IPR004868   DNA-dir_DNA_pol_B_mt/vir       
IPR036875   Znf_CCHC_sf       
IPR000331   Rap_GAP_dom       
IPR035974   Rap/Ran-GAP_sf       
SUPFAM
SSF88723   SSF88723        + More
SSF53098   SSF53098       
SSF81338   SSF81338       
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF111347   SSF111347       

Ontologies

Topology

Length:
768
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00309
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00021
outside
1  -  768
 
 

Population Genetic Test Statistics

Pi
349.407447
Theta
167.902165
Tajima's D
3.426216
CLR
0.137698
CSRT
0.992050397480126
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号