SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15636
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.642
 

Sequence

CDS
ATGGAGGAAAAAAATATGGAAAAATTAATAGAAATACTAGATAAGAAACTCAACAATCAAACACTTGTTATTACAACTTCTGTAACGAAAAATGTAATGGAAGCGCTTGATGAAAAGATGAAACTTATCATGAAGGAAAATAGTATACTCAAAGCCAAAATTACTGAACTAGAAACGGAAGTGAAGTTTTTGAAAGATGAAAAACGGAAAAACAATCTAGTATTTTTTGGGATAGAAGAAATAGGAAAAACTGAATGTGAGCTTGTAGACTGCATAAAGGATCTCATAGTGGACTCGGGAACACAGCTGGATAGTAATGAAATCAGTAAAATATACAGAATTGGAAAACAGGTCAACAACAAAAACCGCCCAGTCGTAGTCACTATTACAACACTTTGGAAAAAGCACTTGATATTGCGAAATAAGTCAAATCTTCCGCAAGGAACATATATCAAAGAAGACTATACCAAAGAAGTGCTAGAAAAACGCAAGCAACTGCAGATACAAGTAGAAGAAGAAAAGAAGAAAGGAAATGTTGCGTTCATAAAATATGATAAATTAGTAATAAAGAAAACCAGAGACAACAACACAGAAAAACGAAAAAGAGAAGAGTCAGGCTCGCCAAACTCTTCAAATCAAAAGAAAACTGCTGTACTCAAGACACAAAGCAACACAGGGACCAAAACTACAGGAAAAGATATACTAAGACCTAATATCCTTAACTATGTTGAAAGAGGAAGATCTGCTTCACTATCGGAACTACCAAAAAACTTCACCCCAATCCGGCCAGTCACCGTGGGGGAAGAAGACTATTACCCTTCAACCATCGCACAACCAAACATTCCTCCTAAAAAACATCGCCACATAGAAGACTACATACACATAGCAACTTTAAATACGTTATCCTTAAGAACTAATGAGAGCCTATCAGAATTAATGCTGGCTTTAGGAAAAATTAAGTGGTCAATACTGGGCCTGAGTGAAGTCCGACGCATGGGCGAGAGTATAGAAGATCATGGGCATTTTATATTTTACTATAAAGGGGAAACACCAGGCCTATATGGAACAGGATTTCTAATCAAACATGAACTAAAACCTTTCATTGAAGAGTTCATTGGTGTCACAGAGCGTATTGTAATACTCAACATAAAACTACCTCCAAAGAACGAAAAGTGGTCGATTATACAAGTCTATTCCCCAATAGAACAAGCAAGTGAAACAGAAATTGATACCTTTTACTCCATTTTACAAGACACAATAAAGAGTCGCTCACATAACAACTTAGTAGTTATGGGAGACTTCAATGAAAGAACGGGGGCAAGAGCAGATGGAGAACAAATAATATTAGGCCCATATTGCTCAGGCAAAAGAACAAGAAATGGGGAGAAACTCTTACTACTTGCTTACGAAAATAACTTAAAAATATTAAACACCTTATATAGAAAACGTGAGAACAACAGATGGACATGGACATCCCCAGATGGCCGCCATAAAAATGAAATAGATTTTATACTAACAAACAAAAGTAAAGACTTCCGAGACTGTAGAACTTTAAACAATATTAACTTTAACAGCAATCATAGGATGGTAAGAGCTAAGTTACAAACAAACGCACTCAAGCAAAATAGACCCTTCAAAATAAAGCACGCCAACACCGGAACATTAGATAATACCGATTCACTAAAAGGAAAGCTCGAGCAATTTATAGAAAAAACAAAGGACCTAGACATACAAATTAAATACAATAAATTCCAAGAACTTCTATACAATAAAGGCAAATTAGAAAACAAAATCAACAAGAGAGATTGGGTATCTAACAAAACTAAAGAACTGTTAAGAAATAGAGCAGACCTTATATCTAACTTAGAAAAGACGAAAACGATAAGAAACGAAATAGCCAAAATTAGTAAAGTAATTAAAACACACATGAGAAAAGACCGTCAGAGATATAGATTGGAACAACTTGAAAAATGTATAAAAAGAACTGGAGGCACCAAAAAAGCAATGGAAGTGAATTACCGGATATAA
Protein
MEEKNMEKLIEILDKKLNNQTLVITTSVTKNVMEALDEKMKLIMKENSILKAKITELETEVKFLKDEKRKNNLVFFGIEEIGKTECELVDCIKDLIVDSGTQLDSNEISKIYRIGKQVNNKNRPVVVTITTLWKKHLILRNKSNLPQGTYIKEDYTKEVLEKRKQLQIQVEEEKKKGNVAFIKYDKLVIKKTRDNNTEKRKREESGSPNSSNQKKTAVLKTQSNTGTKTTGKDILRPNILNYVERGRSASLSELPKNFTPIRPVTVGEEDYYPSTIAQPNIPPKKHRHIEDYIHIATLNTLSLRTNESLSELMLALGKIKWSILGLSEVRRMGESIEDHGHFIFYYKGETPGLYGTGFLIKHELKPFIEEFIGVTERIVILNIKLPPKNEKWSIIQVYSPIEQASETEIDTFYSILQDTIKSRSHNNLVVMGDFNERTGARADGEQIILGPYCSGKRTRNGEKLLLLAYENNLKILNTLYRKRENNRWTWTSPDGRHKNEIDFILTNKSKDFRDCRTLNNINFNSNHRMVRAKLQTNALKQNRPFKIKHANTGTLDNTDSLKGKLEQFIEKTKDLDIQIKYNKFQELLYNKGKLENKINKRDWVSNKTKELLRNRADLISNLEKTKTIRNEIAKISKVIKTHMRKDRQRYRLEQLEKCIKRTGGTKKAMEVNYRI

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR027124   Swc5/CFDP2       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
675
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0014
Exp number, first 60 AAs:
0.00084
Total prob of N-in:
0.00056
outside
1  -  675
 
 

Population Genetic Test Statistics

Pi
165.70066
Theta
178.118122
Tajima's D
0.592715
CLR
0.521585
CSRT
0.533423328833558
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号