SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15631
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Location in the cell
Nuclear   Reliability : 4.001
 

Sequence

CDS
ATGGAGAAAACTGAAAATACAATTGAAATTCCTATTGAGTGCAAGGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGATGATAATGATATCACATATATTCCAGAAGCTTCTTCAATAAGTGACTCATATGACAGTTTTTCTGAAACAGCATCAGAACCAGAACCTTCATTATTAGAATTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTAGCTATAGTCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCAGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGATATTTAAAATCTAATTAA
Protein
MEKTENTIEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSISDSYDSFSETASEPEPSLLELNQDIPNKRVRKIPDRFSYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVQCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSN

Summary

EMBL
AGBW02010203    OWR48976.1    GBHO01019780    JAG23824.1    GBHO01019781    JAG23823.1    + More
GDHC01011760    JAQ06869.1    GANO01000659    JAB59212.1    GANO01000660    JAB59211.1    KQ460882    KPJ11482.1    OIVN01004680    SPD18741.1    GBHO01038523    JAG05081.1    OIVN01005285    SPD21760.1    OIVN01003414    SPD11066.1    LKAM01000003    KUM49280.1    ASHM01006021    PNY13361.1    OIVN01001114    SPC90048.1    OIVN01002365    SPD03017.1    OIVN01003620    SPD12483.1    OIVN01001336    SPC92838.1    OIVN01003223    SPD09609.1    OIVN01002001    SPC99720.1    OIVN01002225    SPD01801.1    OIVN01006243    SPD28737.1    OIVN01000459    SPC80612.1    OIVN01004260    SPD16354.1    OIVN01006118    SPD25470.1    OIVN01003416    SPD11073.1    OIVN01000817    SPC86004.1    OIVN01001779    OIVN01003965    SPC97547.1    SPD14614.1    OIVN01000702    SPC84305.1    OIVN01000354    SPC78868.1    OIVN01000822    SPC86055.1    CM003613    KYP57192.1    OIVN01002280    SPD02253.1    OIVN01001872    SPC98448.1    OIVN01006344    SPD31070.1    OIVN01000403    SPC79640.1    OIVN01001384    SPC93353.1    OIVN01000452    SPC80504.1    OIVN01001628    SPC96029.1    GEVM01025909    JAU80029.1    OIVN01001171    SPC90720.1    DF237331    GAQ87846.1    CM007895    OTG23274.1    BEGY01000018    GAX76480.1    ASHM01093982    PNX64819.1    DF238519    GAQ93484.1   
Pfam
PF07727   RVT_2        + More
PF00665   rve
PF13976   gag_pre-integrs
PF13961   DUF4219
PF00098   zf-CCHC
PF00078   RVT_1
Interpro
IPR039537   Retrotran_Ty1/copia-like        + More
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR013103   RVT_2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR025724   GAG-pre-integrase_dom       
IPR025314   DUF4219       
IPR000477   RT_dom       
SUPFAM
SSF57756   SSF57756        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
281
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0212
Exp number, first 60 AAs:
0
Total prob of N-in:
0.07790
outside
1  -  281
 
 

Population Genetic Test Statistics

Pi
214.031464
Theta
115.031792
Tajima's D
2.738402
CLR
181.304689
CSRT
0.96275186240688
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号