SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15581
Pre Gene Modal
BGIBMGA010726
Annotation
PREDICTED:_ABC_transporter_G_family_member_20_[Papilio_polytes]
Location in the cell
PlasmaMembrane   Reliability : 4.634
 

Sequence

CDS
ATGCCAGCTTACGACAATGAAGGAGCCACGATATCCATGGAGGACGTCCGGGAAATCGACCGTCCAATCACCATTAGCACCATAGAAGAAGAGCTAATAGCCAGAAGAAACAGAATGTTCAAAACTCAAAAGTCCACAGTTGCTTCTAGGAGGCAGCAAGCGGTGTGTGTCAGACGAGCGCACAAAAGATATGGAACAGCTAAAAACCCTAACGTTATTTTGGATGGTCTGAATATGACTGTTGCTAAAGGATCTATATATGGCCTTTTGGGTGCTTCTGGCTGCGGCAAGACCACACTGCTGTCGTGTATAGTCGGCAGACGAAGACTAAATTCTGGTGAGATCTGGGTGCTGGGTGGAAAGCCCGGAAGCCCTGGCAGTGGAGTCCCTGGGCCTAGAATAGGATATATGCCACAGGAAGTCGCGCTCTTCGGCGAATTTTCGATCAGAGAAACACTAATATATTTCGGTTGGATCGCGAACATGTCCACTCCACAAGTAGAAGAACGAATAGACTTCCTCATCAAGTTATTGCAGTTACCTAATCCTACAAGACAAGTCAAAAATTTATCTGGGGGACAACAAAGAAGGACTTCTTTAGCCGCTGCCCTTATTCACGATCCTGAGCTGCTTATCCTGGACGAGCCTACAGTTGGAGTGGATCCTGTGCTCAGACAAAGCATCTGGGATCATCTCGTGGATATAACAAAGGAAGGTCGGACAACAGTGATCATAACTACTCATTACATCGACGAAACAAAACAAGCTAACATGATTGGCCTTATGCGAGGCGGTAGATTTTTGGCTGAAGAGTCTCCGAGCGAGTTGATCAGCCGCTACAACGCCGAAAGCCTTGAAGAAGTGTTCCTGAAGCTGTCAGTGCTACAGAATCTAGGCAAGCGCCGAAGATCTAGCATTCTCGCTGATGTCGTTGAAAAAGTTGAGCTTCCTACTATGCCTGATCCATCAGCCATAGATTTGGAGGAAGCAGAAGTAGGAGAGATTTCCGGAGAGTTCGGTGACAACGTCTCGATGAGCAGTAAAGGAAGGGTTGTAGTGGCACCGGACCTACCAATTCCAGTAGAAGCTATACCCCCTGAAGAGAAACCGAAGAGGACAAAAATGGAAATGATCATGCCAATGAAATGGCATCACATGAAAGCTCTAATATGGAAGAACTTCTGGAGTCTATTTAGGAACTTTGGTGTATTAGCGTTCATAATGGGCTTACCGATATCGCAAATGGTCTTATTCTGCCTCGCTATCGGTCATTATCCTGTTGGTCTTCCCATAGCGGTTGTGAATTACGAGTCTCACAGCAGCGATCCGTTGTGTTATTATGACCAGAAGAAATGCCCTCAAGACCGCAGCACGTACGATTGGCATTTGACGAACTTTAGCTGCCGTTATTTGGATTTCCTATCGAAGCGGCAGAGCAATCTGATCCTGTACCCCAACACTGAAGAAGCCATGTCGGAAGCAGCCCACGGCAAAGCCAGGGTCGTTCTGGTGTTCCCTGCCAATTTCTCAACTTGTCTTCAAGAAAGAATCACGAATCCACGCCGCACAGATGACTACACTATTATGAATTCCGATGTAGAGATCCACATGGATAATACAGATAAACAAGTCGAATGGATGTTGAGTCGCGATCTGCAGCTTGCGTTCATGGACGCTACACAGGAGCTGGCGAAGATCTGTCAGCTACCCTCGAGAATGATGTCCATTCCGGTGCACTTCAATGAGCCTATCTATGGTCTAGATGAGGCCAACTTCACCGATTTTGCTGGACCGGGAGTAATATTAACTATCATATTTTTCTTGGCGGTGGCTTTGACTTCAGGGTCTATGCTGGCTGAAAGAAATGAAGGCATCCTTGAAAGGACTCTAGTTTCAGGAATCACTGGTACAGAGATTCTGTTCTCACACGTCACGGTACAAATGCTGGTGATGATAGCCCAGTCGGTCATTGTCTTGGTCATCGGCTTCGTGTTCTTTGGACTCACGATGAGAGGTCCTATTGGATGGGTCACATTCCTCACACTGATCACTGGATTGTGTGGAATGACTTTTGGTTTCGTCGTGTCCTGTGTTTGTGACACCGACAGAACAGCTACTTACCTGGCTCTTGGCTCGTTCCTGCCGATGGTGTTACTTTGCGGCATCATATGGCCCGTTGAAGGTATGCACCTGATTCTACAGTGGATCAGCTACATTCTTCCGCTTACGAAATCTACAGAGTCTCTCAGATCGATGCTACAGAGAGGTTGGACTATCAATGTACCCACTGTCTACTCTGGATTCATATCAACCGGAATTTGGATAGCTATTTATTTGACCACAAGTATTTTACTACTTAAATTTAAGAAAGGCTAA
Protein
MPAYDNEGATISMEDVREIDRPITISTIEEELIARRNRMFKTQKSTVASRRQQAVCVRRAHKRYGTAKNPNVILDGLNMTVAKGSIYGLLGASGCGKTTLLSCIVGRRRLNSGEIWVLGGKPGSPGSGVPGPRIGYMPQEVALFGEFSIRETLIYFGWIANMSTPQVEERIDFLIKLLQLPNPTRQVKNLSGGQQRRTSLAAALIHDPELLILDEPTVGVDPVLRQSIWDHLVDITKEGRTTVIITTHYIDETKQANMIGLMRGGRFLAEESPSELISRYNAESLEEVFLKLSVLQNLGKRRRSSILADVVEKVELPTMPDPSAIDLEEAEVGEISGEFGDNVSMSSKGRVVVAPDLPIPVEAIPPEEKPKRTKMEMIMPMKWHHMKALIWKNFWSLFRNFGVLAFIMGLPISQMVLFCLAIGHYPVGLPIAVVNYESHSSDPLCYYDQKKCPQDRSTYDWHLTNFSCRYLDFLSKRQSNLILYPNTEEAMSEAAHGKARVVLVFPANFSTCLQERITNPRRTDDYTIMNSDVEIHMDNTDKQVEWMLSRDLQLAFMDATQELAKICQLPSRMMSIPVHFNEPIYGLDEANFTDFAGPGVILTIIFFLAVALTSGSMLAERNEGILERTLVSGITGTEILFSHVTVQMLVMIAQSVIVLVIGFVFFGLTMRGPIGWVTFLTLITGLCGMTFGFVVSCVCDTDRTATYLALGSFLPMVLLCGIIWPVEGMHLILQWISYILPLTKSTESLRSMLQRGWTINVPTVYSGFISTGIWIAIYLTTSILLLKFKKG

Summary

EMBL
BABH01016791    BABH01016792    ODYU01001121    SOQ36891.1    KQ459078    KPJ03812.1    + More
LADJ01026996    KPJ21158.1    AGBW02010306    OWR48761.1    ADMH02000693    ETN65298.1    ATLV01027119    KE525423    KFB53972.1    GGFJ01002329    MBW51470.1    GGFK01006087    MBW39408.1    AXCN02001466    AXCM01000158    AAAB01008859    EAA08206.4    APCN01000271    CH477344    EAT43031.1    GAPW01000262    JAC13336.1    CVRI01000047    CRK97747.1    GFDL01005512    JAV29533.1    KQ971372    EFA10297.1    KA647650    AFP62279.1    JRES01000664    KNC29441.1    GDHF01028806    JAI23508.1    CH954182    EDV53553.1    CM000160    EDW98635.1    GBXI01010069    GBXI01008924    GBXI01007441    GBXI01000817    JAD04223.1    JAD05368.1    JAD06851.1    JAD13475.1    CM000070    EDY68204.2    CH479182    EDW33967.1    BT003531    AE014297    AAO39535.1    ABC66191.1    GAMC01012770    GAMC01012769    JAB93785.1    CH902661    EDV33988.1    CH964272    EDW84120.1    OUUW01000007    SPP83285.1    CP012526    ALC45695.1    CM000364    EDX14541.1    CH940650    EDW66932.1    GFXV01006502    MBW18307.1    MH172535    QAA95942.1    GFDF01009575    JAV04509.1    GL448287    EFN84917.1    KQ979021    KYN24358.1    CH933806    EDW15725.2    KQ982717    KYQ51719.1    KQ435180    KZC14992.1    CH480828    EDW45106.1    KQ760176    OAD61646.1    KQ981685    KYN38051.1    KQ414915    KOC59442.1    GL888207    EGI65056.1    UFQT01000937    SSX28081.1    GEBQ01016518    JAT23459.1    KQ976433    KYM87308.1    KK107293    EZA53289.1    GEDC01007530    JAS29768.1    KQ978473    KYM93686.1    ABLF02033861    NNAY01000251    OXU29694.1    LBMM01009052    KMQ88436.1    APGK01029562    KB740735    KB632302    ENN79196.1    ERL91767.1    BT127039    AEE62001.1    JR052559    AEY61724.1    GECZ01002834    JAS66935.1    CCAG010012701    CCAG010012702    CCAG010012703    GDAI01001971    JAI15632.1    KZ288474    PBC25293.1    GBYB01000940    GBYB01000941    JAG70707.1    JAG70708.1    KQ435812    KOX72863.1    DS232211    EDS37539.1    GBRD01017619    JAG48208.1    GDHC01012408    JAQ06221.1    KF828807    AIN44124.1    GEZM01086010    JAV59839.1    GBHO01006224    JAG37380.1    GL438234    EFN69284.1    NEVH01020342    PNF21462.1    GBGD01000603    JAC88286.1    GBBI01002817    JAC15895.1    GECL01003381    JAP02743.1    QOIP01000005    RLU22987.1    JTDY01000691    KOB76203.1    GFTR01007880    JAW08546.1    GBHO01006230    JAG37374.1    KK852806    KDR16094.1    JXUM01003433    KQ560158    KXJ84121.1    KYB25373.1   
Pfam
PF01061   ABC2_membrane        + More
PF00005   ABC_tran
Interpro
IPR003593   AAA+_ATPase        + More
IPR013525   ABC_2_trans       
IPR003439   ABC_transporter-like       
IPR027417   P-loop_NTPase       
IPR000412   ABC_2_transport       
IPR017871   ABC_transporter_CS       
IPR000515   MetI-like       
SUPFAM
SSF52540   SSF52540       
PDB
4YER     E-value=1.27885e-25,     Score=292

Ontologies

Topology

Length:
791
Number of predicted TMHs:
5
Exp number of AAs in TMHs:
134.83892
Exp number, first 60 AAs:
0
Total prob of N-in:
0.35814
outside
1  -  595
TMhelix
596  -  618
inside
619  -  638
TMhelix
639  -  661
outside
662  -  675
TMhelix
676  -  698
inside
699  -  704
TMhelix
705  -  727
outside
728  -  763
TMhelix
764  -  786
inside
787  -  791
 
 

Population Genetic Test Statistics

Pi
256.966313
Theta
23.738279
Tajima's D
0.043394
CLR
0.738173
CSRT
0.390530473476326
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号