SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15527
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.083 Nuclear   Reliability : 1.476
 

Sequence

CDS
ATGATGGCACACTTTAAAACAAAATTACCCCAGGAGGGTACCACCCTAGGTGGAGAATCCCTCCGTGCTTCCACCTCGGTGGAAGCATGCTGCCCCGCGTATTCTGGGGGGGGCAAAGCATGCCACGGTGAAGGGGGCTGTGCGACGGGCAGCGGAAAACCCGTCGAACCGAGGTGTGACAGCGCTGGCTCGACGCGCTCTGCGCTCGTCAGCGAAGGCGAGGCGGCTGGTCCGAAAGGGACAACCGCCAAGAAGGTGAGGCGGAAGAGGAAGTCTTGGCGAGCTTCCTCTCGCGAGGGGGTAGGGGAGCCAGCGTCATCCTCTGGCGCAGATGCCCCGCCGGAAAAGGTGTTGGTAATCTCCGATGCAGCCTCTGCTGCGGAGGAGATGCCGCCCCCTAGAGGGAGACCCGCCCGGAAAAGGGGCGCGCCGTCACCGGCGCCATCATCAGTCTCAATGTCTGTCGCCTCGTTGGATGGGCAGACGACAGAGGAGGAAGAGAGCGGCCTTCAGGATCCTGCCATGGTCATAGACAGGGCCATGAAGACCGTGAAATCATACGCGGCCAATGGCACCAAGACCAAAGTCGCTGGCCGTAAACTGCGAGAAGTGGTCTCGCAGGTCTCGAAAGTTCTGCCATCAGTTGCTTCTGCCAATGACCGGGTGGTACAGCTGATGGCGGAGAATTCGAGACTTCGAGCACAGCTCCAAGCTCGGCAACGGCCCGATGATGGAGCAGCGACGTCCTGGGTCGCTGGAGCCCCTCGGAGCTCCCGTCTCCCGGCGCTGACTGGTGATCAGTGGCCTGTGCTGCCACCACCGCGTGCGGCACAGGAGCGTCCGCGTCTCCCGTCGCCGCGCTCTAGAGAGACGACCGCCGCCGAGCGGCAGCAAGCACTCGCGGGGCCACGGATGCTGGCTCCGCCAGAACCGAAGGCCTTCAGCCTGGACGAGGTCATCAACCGCACCGTCCAGGCTGTAGTAGAAAAGCTGGGCGGCAGGCTAGCGGCTCTCGAGGCGAGAGTGACTGCTTCGGCCGACGTTAGACAACCGGCGGTGTCGGGTGCTTTGGCCACCCGTTCCGCTCCCGTACGGGCTCCGGCCACCAGGTCGGGCCCGGGACGAGATCGAACCAAACAAGGGGGTGGCGCTAACGCGAAGCCTCCATCACAAGCACCCCAGTCCCGTCCGCTGCCTCCGCCCCCGTCAAACATGGACGAGGGGTGGAACGTGGTGGCCCGGCGGGGTGCCAAAAAGGCTTCACTGGGAGCTCCCCAAATGGGTAGAGCGTTAGTGGCCATGGCGGCTCAGGCTGCACCCCAACAGGGTCGAGCACCTGTAGCCGTCAATAAAAAGAAAAAAACTAAAAAAGGGAAGAAGTCGCCGCGGGCGCCGCGATCAGCGGCAGTGGTTATAACTTTACTGCCTGCCGCTGAGGCCAAGGGCATGACATATAATAATGTGATGGCCCGGGCGCGTGAAGCAATCAACCTGGACGAGATTGGGGCGGAGGAAGGCCTCCGCAGCAGGCAGACGGCCAATGGGGCCAAGCTGTTAGAATGTCCCGGTGCCGATAGTCCCGGCATCGCGGAGCGTCTGGCGGCGAAGCTCCGTATGGTCTTGCCTGAGGAGGAGGTGCGGGTGCACAGGCCGGTAAAAATGGCGGAATTAAGAGTGACCGGCCTGGACGACTGCACCACCAGGGATGAGGTGAGAGCAGCCGTCGCTACCCAGGGCAACTGTGCACCGGAGAATGTGACCGTGGGTGAGCTGCGCCGTGGTTATACCGGGGCCAGCTCAGTGTGGGTGCGTTGCCCGTTGGAGACGGCTGCCTCCCTGGCTGCTCCTCCGCCCGGGGGACCGTCGGGGAATCCAGGCAGGCTGCGCGTGGGCTGGATGGCGGCCCATGTGCGCCTGCTTGAACCACGCGCCTGGCGATGCCTCCGGTGCTTTAGCACCGGACACGGTCTCGCCAGGTGCACTAGCTCGGTTGACCGCAGCGGTCTGTGTTTCCGCTGCGGCCAGCCGGGCCATAAAGCGGCGTCCTGCGCGGCCGCCCCGCACTGCGCTTGGTGCGCTGCGGCCGGGCGCGGGGCTAACCACCGAGCGGGAGGAAAGGCGTGCCTCCCGTCCGGTGATAACACCGAACGCAACCGGCACCGGAAGTCAAAGCGCCGGCAGAAGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGCTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGTGGGGGCAGCGGAAACCTGAACCACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGTATGGCGGAGTGGTCTATAGATGTGGCTGTGGTCGCCGAGCCATATTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGGCGGCCTGGCGGCCATAGCCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTCGCTCCCCGTCCAGTGATTCTCGCGGGGGATCTCAACGCGAAAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACGTTCGCGAGCCCAGCCATCGCGCGCCGTATCTGCGACTGGAAGGTTTTGGAGGGGGCGGAGACGCTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCACAGTCGCAGACGTCCACGGGGACCACCCCCGTAGTGCGTCTCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTATAGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGCGAGGCGGGGTGGTTCCGGGACACGATGCGTCGCATTTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGACAGCGCCGCCGCCGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCAGCAGAGGCCCGGCTGCACGGCGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCATGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACGGCGAAGCCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGTGTCCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTAGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTTATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATTCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGGCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTACGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGACGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MMAHFKTKLPQEGTTLGGESLRASTSVEACCPAYSGGGKACHGEGGCATGSGKPVEPRCDSAGSTRSALVSEGEAAGPKGTTAKKVRRKRKSWRASSREGVGEPASSSGADAPPEKVLVISDAASAAEEMPPPRGRPARKRGAPSPAPSSVSMSVASLDGQTTEEEESGLQDPAMVIDRAMKTVKSYAANGTKTKVAGRKLREVVSQVSKVLPSVASANDRVVQLMAENSRLRAQLQARQRPDDGAATSWVAGAPRSSRLPALTGDQWPVLPPPRAAQERPRLPSPRSRETTAAERQQALAGPRMLAPPEPKAFSLDEVINRTVQAVVEKLGGRLAALEARVTASADVRQPAVSGALATRSAPVRAPATRSGPGRDRTKQGGGANAKPPSQAPQSRPLPPPPSNMDEGWNVVARRGAKKASLGAPQMGRALVAMAAQAAPQQGRAPVAVNKKKKTKKGKKSPRAPRSAAVVITLLPAAEAKGMTYNNVMARAREAINLDEIGAEEGLRSRQTANGAKLLECPGADSPGIAERLAAKLRMVLPEEEVRVHRPVKMAELRVTGLDDCTTRDEVRAAVATQGNCAPENVTVGELRRGYTGASSVWVRCPLETAASLAAPPPGGPSGNPGRLRVGWMAAHVRLLEPRAWRCLRCFSTGHGLARCTSSVDRSGLCFRCGQPGHKAASCAAAPHCAWCAAAGRGANHRAGGKACLPSGDNTERNRHRKSKRRQKRKLARGALANAVIPAAAPVPEGGGSGNLNHSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDGGLAAIAIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRPVILAGDLNAKGSVATCVRWQGESIVDVTFASPAIARRICDWKVLEGAETLSDHRYIRFDLSARSTVADVHGDHPRSASRSFPKWALKRLNKELLMEASIVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARQRRRRLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDAPPDYDGEAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLRLGPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYKWRADLRARGVARPSPSVVRARRGQSRRSVLESWSRRLADPSAGRTTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKTMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=5.5792e-05,     Score=117

Ontologies

Topology

Length:
1747
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.18921
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00002
outside
1  -  1747
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0.196101
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号