SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15517
Annotation
hypothetical_protein_M514_27221_[Trichuris_suis]
Location in the cell
Mitochondrial   Reliability : 1.421 Nuclear   Reliability : 1.532
 

Sequence

CDS
ATGTGGTACGAATATTTTCCTAATATTACACCTATTGAATGGGCTACACCCACAGTTAACATTCTGAAATCTACAGGGGAAATTAGGATATGTGGAGACTACAGAACTACACTTAATCCAGTACTTATTAAACATCTACACCCAGTTCCGATTTTCGATCAACTACGCCAAAATCTCGCAAACGGTAAATTATTTTCAAAAATAGACCTTAAAGACGCATACTTACAATTTGAAATAGCACCAGATTCGAAAAAGTACTTGACGTTGTCAACCCATAAAGGGTATTTCCAATACAATAGAATGCCTTTTGGAATATCGACTGCTCCTTCAATTTTTCAACATTTTCTGGATCAACTGCTAGGCGATATCACCAATGTAGCTGTATATTTTGACGACATAGCTATAGCAGGGAAAGATCTTTCAGAACATTTACAAACTTTATCTATTGTATTCGATCGCTTACAAAACGCTGGCCTAAAAGTTAATTTAAAGAAATATACAAAGAAATGCATAGCTTCTTCACAACCATTAATTGCATTTGACGAGAAACGTCCCCTTTATTTAGCATGTGACGCTTCCGAAAAGGGATTGGGTGCAGTATTATTCCACAAGGACTCGAACATAGAACAGCCAATTGCTTTTGCTTCAAGGAAACTACGACCAGCGGAAATGAAATATTCCGTTATTGATCGTGAAGCTTTAGCAATAGTATTTGGTATAAAAAAATTTGATCAGTACTTGAGAGGAACGAAATTTAATCTAGTTACGGACCATAAGCCTCTTATACATATTATGGGTGCACGCCGCAACCTTCCTAAACTAGCCAATAACCGATTGGTAAGATGGGCCCTAGTAGTGGGAAGTTATCAATATGACATTTACTACAGGAAAGGTGAAAATAACACATTAGCTGATTGCCTTTCCAGATTACCAAACCCTGAAACTGAACCCTCCGAGACAGAAGGGCTTGTACATAAAATAGATCTACGTCTTTTGAGCACTCGAATGACTGACCTTAACCTTTCAGAACAGTTACTTATGAAAACAACTGCAAAGGATCATATACTCACAAAAGTTTGTCAAAATTTAAAAACCGGCTGGAGAGAATCAGAATACAATCCAGAGATGAAACCATTCTACAGAAACCGGACTGAATTATCTGTTGAGAATAAGATACTTATGAGGCAAGGACGCATCGTTATACCTACAGCACTCCGAAAAGCCATTCTTACATACCTTCATCGAGGACACCCTGGCATTTCTGCTATGAAAGCACTTTCACGTTACTATGTTTGGTGGCCTAACCTTGACGAAGACATAGAATTATTTGTCAAGAAATGTACCAGATGCCAACAGAACCGCCCTTGTAATCCTGAACTTCCTGTATTTTCCTGGTCCATACCAGAAGAAGTATGGGAGAGAATCCATATCGACTTTGCTGGACCGTTCGAAGGATCGTATTGGTTGGTATTGTGCGACGCTCTCTCCAAATGGGTGGAAATACGACCGATGAAACACATCAACACCAGATCACTTTGTCTTACATTAGATAACATATTTTGTACATTTGGCTTACCAAAAATGATTATATCCGATAATGGACCCCAATTTACATCTTATGAATTTAAAGAATATTGCACAAAACAGTCTATTTTACATGTCACATCATCCCCATATCATCCTCGGACAAATGGGCTGGCAGAACGTTTAGTCAGAACATTCAAAAATAGAATGGCATCGGTAGACAACACAAATCTCGAGCGCCGACTATTAGAATTTCTGTTTACATACAGAAACACTCCGCACTCATCCACTGGTAAATCTCCAGCTGAGATGATGTTTGGAAGACAATTGAATTGCATACTTTCCAACATTCGGCCAGACAAAAGAAGGTTAATGCAGTATTTACAAGTAAAAGAAAATATAATAATGATAGGTAGCAAAAATGACAATGTGTTTGAAGTATATTTCAAATAA
Protein
MWYEYFPNITPIEWATPTVNILKSTGEIRICGDYRTTLNPVLIKHLHPVPIFDQLRQNLANGKLFSKIDLKDAYLQFEIAPDSKKYLTLSTHKGYFQYNRMPFGISTAPSIFQHFLDQLLGDITNVAVYFDDIAIAGKDLSEHLQTLSIVFDRLQNAGLKVNLKKYTKKCIASSQPLIAFDEKRPLYLACDASEKGLGAVLFHKDSNIEQPIAFASRKLRPAEMKYSVIDREALAIVFGIKKFDQYLRGTKFNLVTDHKPLIHIMGARRNLPKLANNRLVRWALVVGSYQYDIYYRKGENNTLADCLSRLPNPETEPSETEGLVHKIDLRLLSTRMTDLNLSEQLLMKTTAKDHILTKVCQNLKTGWRESEYNPEMKPFYRNRTELSVENKILMRQGRIVIPTALRKAILTYLHRGHPGISAMKALSRYYVWWPNLDEDIELFVKKCTRCQQNRPCNPELPVFSWSIPEEVWERIHIDFAGPFEGSYWLVLCDALSKWVEIRPMKHINTRSLCLTLDNIFCTFGLPKMIISDNGPQFTSYEFKEYCTKQSILHVTSSPYHPRTNGLAERLVRTFKNRMASVDNTNLERRLLEFLFTYRNTPHSSTGKSPAEMMFGRQLNCILSNIRPDKRRLMQYLQVKENIIMIGSKNDNVFEVYFK

Summary

EMBL
KL367659    KFD60588.1    GBHO01042589    JAG01015.1    GBHO01042596    JAG01008.1    + More
LSMT01000238    PFX22483.1    KL367712    KFD59941.1    GDHC01014693    GDHC01004534    JAQ03936.1    JAQ14095.1    GFTR01008725    JAW07701.1    KL363234    KFD51952.1    JWZT01000439    KII74358.1    GBHO01045651    GBHO01045644    GBHO01026684    GBHO01026679    JAF97952.1    JAF97959.1    JAG16920.1    JAG16925.1    JYDL01000067    KRX18868.1    JWZT01002984    KII68048.1    JWZT01004052    KII64969.1    JWZT01005674    KII60352.1    AZHX01001899    ETW98900.1    GEGO01004818    JAR90586.1    GEFM01006397    JAP69399.1    AERX01052799    AERX01052800    GFAA01002662    JAU00773.1    JYDK01000060    KRX78865.1    JYDO01000377    KRZ65389.1    JYDQ01000223    KRY10622.1    JYDL01000080    KRX17894.1    GEGO01004800    JAR90604.1    AAGJ04101977    MRZV01000005    PIK62810.1    EF199622    ABM90393.1    JYDI01000800    KRY43965.1    KL367976    KFD59423.1    JYDN01000036    KRX62859.1    JYDN01000181    KRX54086.1    AERX01039690    HADW01008367    SBP09767.1    JYDW01000348    KRZ48953.1    GEFM01002211    JAP73585.1    GEGO01004546    JAR90858.1    KRX54093.1    JYDH01000010    KRY40903.1    HADX01010638    SBP32870.1    LSMT01000343    PFX19819.1    EF199621    ABM90392.1    JYDT01000070    KRY86520.1    HAAD01006009    CDG72241.1    NIVC01000551    PAA81070.1    NIVC01000050    PAA92506.1    MRZV01000143    PIK57404.1    HAEH01013823    SBR98409.1    KL367587    KFD62819.1    GBIH01000761    JAC93949.1    NIRI01001153    RJW67559.1    GBHO01027659    JAG15945.1    LSMT01000232    PFX22695.1    GEBQ01020673    GEBQ01011946    JAT19304.1    JAT28031.1    GACK01009588    JAA55446.1    JYDI01000102    KRY52595.1    GEGO01004812    JAR90592.1    GDHC01007869    JAQ10760.1    KL363640    KFD45214.1    KRX62850.1    GBHO01042583    JAG01021.1    GCES01151725    JAQ34597.1    JYDI01000010    KRY59721.1    GEGO01004729    JAR90675.1    NIVC01000075    PAA91739.1    GCES01042893    JAR43430.1    LSMT01001659    PFX12008.1    GEGO01003414    JAR91990.1    JYDQ01000025    KRY20467.1    NIVC01001308    PAA69606.1   
Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF00098   zf-CCHC
PF05147   LANC_like
PF00077   RVP
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR000477   RT_dom       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
IPR041577   RT_RNaseH_2       
IPR001995   Peptidase_A2_cat       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR041373   RT_RNaseH       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012341   6hp_glycosidase-like_sf       
IPR020464   LanC-like_prot_euk       
IPR007822   LANC-like       
IPR034128   K02A2.6-like       
IPR018061   Retropepsins       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
Gene 3D
PDB
4OL8     E-value=1.0207e-20,     Score=249

Ontologies

Topology

Length:
658
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00872999999999998
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.00068
outside
1  -  658
 
 

Population Genetic Test Statistics

Pi
239.819761
Theta
144.17596
Tajima's D
2.000867
CLR
11.637196
CSRT
0.87935603219839
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号