SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15513
Annotation
PREDICTED:_uncharacterized_protein_LOC101747137_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 1.779 Mitochondrial   Reliability : 2.23
 

Sequence

CDS
ATGCACACGTTCACCGATGCTAGCGAGAAGGCCTACGCGTGTGCAGTCTATTGGCGTCAGAAGACAGACGAGAGCACCTACCGCGTCACGCTTCTAGCAGGGAAAGCCAGGGTGACCCCACTGAGACCAGTCTCTATCCCAAGGCTGGAGCTGCAAGCTGCGCTGCTGGGGACAAGGATGGCGCAGGCGATAGCGGACGAATTGGACATCGCAGTCGGTGTAAGGACGTACTGGACTGAGTCCAGTACAGTCCTGACATGGATAAAGACCGACCCACGCACGTTCAAACCTTTCGTCGCGCACCGACTCGCCGAGATAGAAGAGTCAACGAAGCCCCAAGAATGGCGATGGGTGCCTGGCTCGCAGAACCCAGCAGACGACGCAACTAGAGAGGCGCCGGCGGATTTCGACCACACGCATCGGTGGTTTAATGGACCCGAGTTCCTGACGTGGGATGAATCGCGCTGGCCCAAGCCACGAACATTCAAGCAAGAACCGTCTGGAGAGGAGAAAGAGGCCTTCCTGGTCGCCACGGCGAGGACCGCTGACGCTCGATCCACGCCCGATCCGCACAGATTCTCGAGCTGGTCAAAAGCATGGCTGCCGCTTGATCCGCCCCACTTGAAGAAGGCGGAGAAGATCCTACTGAGAAGCAGCCAAGGAGAGAGCTTCGGTGAAAAAGATCCCGAACGTCACCCCAAGTTGCGACGGCTCGACGTCGTGATGGAAGATGGCCTGTTGCGCCTGCGCGGACGTATCGACGCAGCGCAATACATAGATGCAGGCTGCAAGCGACCGATCGTGCTGGACGGGAAGCACGTGATAGCGAGATTATTGATCAAACACTATCACGAGGCGTTCCAGCACGATGCCACAACTCAGTGTGCCTATAAAGCACCTGACCCGCTCGATGGAGATCAAAAATGA
Protein
MHTFTDASEKAYACAVYWRQKTDESTYRVTLLAGKARVTPLRPVSIPRLELQAALLGTRMAQAIADELDIAVGVRTYWTESSTVLTWIKTDPRTFKPFVAHRLAEIEESTKPQEWRWVPGSQNPADDATREAPADFDHTHRWFNGPEFLTWDESRWPKPRTFKQEPSGEEKEAFLVATARTADARSTPDPHRFSSWSKAWLPLDPPHLKKAEKILLRSSQGESFGEKDPERHPKLRRLDVVMEDGLLRLRGRIDAAQYIDAGCKRPIVLDGKHVIARLLIKHYHEAFQHDATTQCAYKAPDPLDGDQK

Summary

EMBL
AF530470    AAQ09229.1    NWSH01008670    PCG62455.1    AB042118    BAA95569.1    + More
AB042119    BAA95570.1    RSAL01000375    RVE42106.1    AAZX01023278    LNIX01000039    OXA39294.1    KQ459986    KPJ18861.1    LNIX01000019    OXA44855.1    LNIX01000015    OXA46575.1    LNIX01000003    OXA57597.1    OXA44812.1    LNIX01000007    OXA52015.1    GGFJ01001462    MBW50603.1    GGFJ01001476    MBW50617.1    LNIX01000004    OXA56382.1    GGFJ01000302    MBW49443.1    GGFJ01000218    MBW49359.1    JTDY01001530    KOB73634.1    GGFL01005193    MBW69371.1    GEHC01000947    JAV46698.1    JXUM01127084    KQ567147    KXJ69602.1    GEHC01000914    JAV46731.1    JXUM01005879    KQ560203    KXJ83865.1    GAMC01017930    JAB88625.1    LNIX01000012    OXA48117.1    GAMC01020594    JAB85961.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    GEZM01052587    JAV74399.1    LNIX01000041    OXA39119.1    GEZM01052586    JAV74401.1    LSMT01000075    PFX28896.1    JXUM01109099    KQ565290    KXJ71123.1    AB110069    BAD01589.1    BAD01590.1    GCES01148879    JAQ37443.1    LNIX01000018    OXA45362.1    OXA55241.1    GGFL01001842    MBW66020.1    GGFL01001682    MBW65860.1    APCN01002024    GEHC01000967    JAV46678.1    JXUM01013493    KQ560378    KXJ82704.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GGFJ01000487    MBW49628.1    GCES01096631    JAQ89691.1    LSMT01000392    PFX18796.1    MRZV01000348    PIK51982.1    LN877231    CTR11689.1    LSMT01000554    PFX16342.1    GGFJ01000306    MBW49447.1    GBYX01477451    JAO04236.1    GGFJ01000432    MBW49573.1    GBYX01477452    JAO04235.1    DNYX01000180    HBK83090.1    KL367687    KFD60188.1    JYDK01000056    KRX79229.1    GEHC01000945    JAV46700.1    LSMT01001506    PFX12229.1    GAMC01020600    JAB85955.1    JXUM01136032    KQ568367    KXJ69026.1    JXUM01031097    KQ560909    KXJ80382.1    GCES01133947    JAQ52375.1    GGFJ01000333    MBW49474.1    JYDW01000048    KRZ59054.1    JXUM01038372    KQ561162    KXJ79503.1    GCES01140786    JAQ45536.1    JYDL01000119    KRX15895.1    OXA55408.1    AAGJ04043389    GCES01111356    JAQ74966.1    LBMM01026421    KMQ82315.1    JYDI01000031    KRY57459.1    AAGJ04115911    JYDH01000309    KRY26933.1    KRY26929.1    JYDJ01000536    KRX34640.1    JYDI01000018    KRY58742.1    JYDN01000069    KRX59701.1    ODYU01003174    SOQ41584.1    JYDR01000056    KRY71589.1    HAEF01019456    SBR60615.1    ABLF02013940    ABLF02036313    ABLF02066938    ABLF02066950    JYDP01000218    KRZ02721.1    KL367527    KFD66131.1    HAEJ01014775    SBS55232.1    JYDS01000532    KRZ03382.1   
Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF00665   rve
PF18701   DUF5641
PF17921   Integrase_H2C2
PF05585   DUF1758
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
Interpro
IPR040676   DUF5641        + More
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR001584   Integrase_cat-core       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
IPR001878   Znf_CCHC       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR019787   Znf_PHD-finger       
IPR001965   Znf_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR011011   Znf_FYVE_PHD       
IPR019786   Zinc_finger_PHD-type_CS       
IPR000253   FHA_dom       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001969   Aspartic_peptidase_AS       
IPR021109   Peptidase_aspartic_dom_sf       
IPR002999   Tudor       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       
SSF57756   SSF57756       

Ontologies

Topology

Length:
308
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00129
Exp number, first 60 AAs:
0.00057
Total prob of N-in:
0.04240
outside
1  -  308
 
 

Population Genetic Test Statistics

Pi
304.796096
Theta
175.611446
Tajima's D
2.060706
CLR
0.387904
CSRT
0.892405379731013
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号