SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15509
Annotation
PREDICTED:_mucin-2-like_[Amyelois_transitella]
Full name
Retrovirus-related Pol polyprotein from transposon TNT 1-94      
Location in the cell
Nuclear   Reliability : 3.895
 

Sequence

CDS
ATGGCTACCAACTACCTTATCAATGTACCGAAACTAAAAGGACGCGATAATTATTCAGAGTGGTGTTTCGCTGCAGAAAATTTTTTAGTACTCGAAGGCATGAAGCATTGCATCAAGCCAGAACCGGGGAAAGAAATAGCAAGCGCGGATGACGAAAAAACTAAAGCCAAATTGATCATGACCATCGACCCGTCGTTGTACGTACATGTCAAAACCGTTAAATCGTCGAAAGAATTGTGGGATAAACTAAGGCAATTATTCGATGATAGTGGCTTTTCACGAAGAATTAGTCTATTGAGAAATTTAATTTCAATCCGGCGAGATAATTGCAGTTCGATGACGTCATACGTGACGCAGATAATCGATACAGCGCAGAAATTAAGTGGAACGGGATTTGAAATAAACGAGGAATGGGTGGGATCATTGCTGTTGGCGGGGCTGCCAGAAAAGTTTGCCCCAATGATCATGGCAATTGAACATTCCGGGATTGCCATAAACTCTGATGTAATTAAAACAAAATTACTTGATATGAGTTCCGAGGTCGGTGACCATGATCCGGAAGTTGCACTATGGTCGAAACCAAAAACGAGGGTAGATCAAAATTTCAATACAAAAGGCGAGAAACGAACATCAAATTATACGTCCAATGTAAAAAAAAAGGTTATAAAATGTTATAAATGTAAGCAAAGTGGTCATTATAAAAATCAGTGTCCGAGTTTAGAAGCCGAAAAAAGAAAACAATCCAACGCCTTTAGTGCTATTTTCTTAAGTGGAAATTTCAACTGCGATAGTTGGTACATAGATAGCGGGGCCAGCAAACACATGACAGCAAAGAAAGAATACGTTGAGAGTCCATCATTTGAACATGAAATTAAAGAAATAATTGTTGCGAACAAAACATCCGTCCCGGTAGTGTGTTCTGGTGATGTAAACATAATCACAGTTGTGAATGGTGTAGAATATGACATCACAGTTTCAAATGTATTGTGCATACCGAGTTTAACAACAAACTTGCTTTCAGTGAGTCAGTTAATTGAGAATGGCAATAAGGTAATCTTTAAAGAGAAATTTTGCTATATTTACAATCAACAGAGAACTCTAGTTGGAAAGGCAGAATTAGTAGATGGTGTGTACAGATTATATACTAAGAAATCAGAACAGTTATTCGCAGCCACAGCTAAGGTGTCGAGTGAAACTTGGCACCGACGATTAGGGCATATCAACAGTACCAGCTTGAACAAAATGAAGAATGGAGCTACGACAGGTATTTCATACACAAATAAAGCTGATGTTGACAAATCTAAGTGTACTGTTTGCTGTAAGGGGAAGCAGTCTAGACTACCTTTTCAGCCTAGTTCAACTAACACCCAAGATATTTTAGAATTAATACACTCAGATGTGTGTGGTCCGATGGAAAATGTGTCCATTGGAGGATCCAGATACTATGTCTTATTTGTGGATGACTACAGCAGAATGGTTTTTGTATACTTCATGAAAACAAAGTCAGAGGTATTTAAGTTTTTCAAAGAATTCCAGTCACTTGTAGAAAAACAGACAGATCGGAAAATTAAAATTCTAAGAACAGACAATGGCGGTGAGTACTGCAGTCAAGACTTTGAAAGATATCTAAAACAACACGGAATAATTCACCAGAAAAGTAATGCTTACACACCACAGCAAAATGGTGTGTGTGAAAGGATGAATAGGTCACTAGTTGAAAAGGCTAGATGTCTAATTTTTGATGCTGGTTTACATAAAAAGTTTTGGGCAGAAGCCATAAATACATCTGTATACTTAAGGAATCGATCAGTTGTTACTGGATTAAACAACATGACTCCATATGAAGCCTGGACAAAGAAAAAACCTGACTTAAGTCATGTACGTATTTTTGGAAGTAAGGTTATGATGCACATACCAAAAGAAAAGCGCTTAAAATGGGATATGAAGGCTAAAGAACTTATTTTGGTAGGCTATGCAGACAATGTAAAAGGCTATAGGGTTTATAACCCAGAAAATAACTCTGTCACAACTAGCAGAGACATTATAATAATGGAGAAAACTGAAAATACAATTGAAATTCCTATTGAGTGCAAGGCTCCAGCGGAGGAACAGAGAGAAGGAGACGAAAGTAGAACTACAGAAAGTACAGACACTGAATGTGATGATAATGATATCACATATATTCCAGAAGCTTCTTCAGGAAGTGACTCATATGACAGTTTTTCTGAAACACCATCAGAACCAGAACCTTCATTATTCTTGAATCAGGATATTCCAAACAAGCGAGTGAGAAAAATACCTGATAGATTTAGCTATAGTCACTTATGTATTGCAGAATCAGATGATCAAAATATAATGGATATTTCACTCAAGGAAGCTTTAAATGGACCTGAAAGTAAATTTTGGAGATCAAGCATGGAGGAGGAATTAGAATCATTTAAGAAAAATGATGCATGGGAACTTGTGGATAAGCCTCGTGACTCTACAGTAGTGCAGTGCAAATGGGTATTTAAAAAGAAGTATGATAGTGTCGGTAATGTGCGTTATCGTGCTAGATTAGTGGCAAAAGGCTTTTCACAGAAAGCTGGCATAGACTATCATGAAACTTTTTCACCTGTGCTACGTTATACTACTTTAAGATTGTTATTTTCTATAGCAGTAAAACTAGGTTTAGATATACGTCATCTTGATGTCACTACAGCCTTTCTAAATGGTTTTTTGAATGAATCTGTGTATATGCAAAAACCTGTCCTTTATAGAGATTGTAATGATAATGATAACAAAGTATTAAAGCTTAAACGTGCCATATATGGACTTAAGCAATCATCTCGTGCTTGGTATCAGAGAGTTAATGATTACTTAGAGTCTTTAGGATATTTAAAATCTAAGTATGAACCGTGTTTGTTTACGAAGTCTGAAGGAAATGCTAAAGTTATAATAGCATTGTTTGTTGATGATTTTTTTGTTTTTTCTAACTGTAAAATGGCAACTAATCAGTTAATACAAGATTTGAGTAGTAAATTTAAAATTAAAGATTTGGGTCAAATAAAGCAATGTTTAGGCTTAAGAGTGAATATGTATAAAAATGCTATAACTGTTGATCAAGAACAGTATATAGAAAGCTTGTTAAAAAAGTTTAACATGTCACATTGTAAAACTATAGAAACTCCTATGGAGATTAACTTAAGATTGGAAAAATCTGAGAATAGTTTATGTAATAAAATATTCCATATAGACAATTAA
Protein
MATNYLINVPKLKGRDNYSEWCFAAENFLVLEGMKHCIKPEPGKEIASADDEKTKAKLIMTIDPSLYVHVKTVKSSKELWDKLRQLFDDSGFSRRISLLRNLISIRRDNCSSMTSYVTQIIDTAQKLSGTGFEINEEWVGSLLLAGLPEKFAPMIMAIEHSGIAINSDVIKTKLLDMSSEVGDHDPEVALWSKPKTRVDQNFNTKGEKRTSNYTSNVKKKVIKCYKCKQSGHYKNQCPSLEAEKRKQSNAFSAIFLSGNFNCDSWYIDSGASKHMTAKKEYVESPSFEHEIKEIIVANKTSVPVVCSGDVNIITVVNGVEYDITVSNVLCIPSLTTNLLSVSQLIENGNKVIFKEKFCYIYNQQRTLVGKAELVDGVYRLYTKKSEQLFAATAKVSSETWHRRLGHINSTSLNKMKNGATTGISYTNKADVDKSKCTVCCKGKQSRLPFQPSSTNTQDILELIHSDVCGPMENVSIGGSRYYVLFVDDYSRMVFVYFMKTKSEVFKFFKEFQSLVEKQTDRKIKILRTDNGGEYCSQDFERYLKQHGIIHQKSNAYTPQQNGVCERMNRSLVEKARCLIFDAGLHKKFWAEAINTSVYLRNRSVVTGLNNMTPYEAWTKKKPDLSHVRIFGSKVMMHIPKEKRLKWDMKAKELILVGYADNVKGYRVYNPENNSVTTSRDIIIMEKTENTIEIPIECKAPAEEQREGDESRTTESTDTECDDNDITYIPEASSGSDSYDSFSETPSEPEPSLFLNQDIPNKRVRKIPDRFSYSHLCIAESDDQNIMDISLKEALNGPESKFWRSSMEEELESFKKNDAWELVDKPRDSTVVQCKWVFKKKYDSVGNVRYRARLVAKGFSQKAGIDYHETFSPVLRYTTLRLLFSIAVKLGLDIRHLDVTTAFLNGFLNESVYMQKPVLYRDCNDNDNKVLKLKRAIYGLKQSSRAWYQRVNDYLESLGYLKSKYEPCLFTKSEGNAKVIIALFVDDFFVFSNCKMATNQLIQDLSSKFKIKDLGQIKQCLGLRVNMYKNAITVDQEQYIESLLKKFNMSHCKTIETPMEINLRLEKSENSLCNKIFHIDN

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Keywords
Aspartyl protease   Complete proteome   Endonuclease   Hydrolase   Metal-binding   Nuclease   Nucleotidyltransferase   Protease   Reference proteome   RNA-directed DNA polymerase   Transferase   Transposable element   Zinc   Zinc-finger  
Feature
chain  Retrovirus-related Pol polyprotein from transposon TNT 1-94
EMBL
GEZM01011857    JAV93390.1    GEZM01011856    JAV93393.1    NWSH01002292    PCG68657.1    + More
PCG68658.1    GEZM01011859    JAV93384.1    KQ459875    KPJ19636.1    KQ460882    KPJ11482.1    GEZM01011855    JAV93396.1    JYDT01000069    KRY86576.1    JYDH01000330    KRY26802.1    JYDS01000009    JYDV01000021    KRZ33483.1    KRZ41218.1    GBHO01033235    JAG10369.1    JYDR01000001    KRY80095.1    NEVH01002725    PNF41351.1    NEVH01019375    PNF22597.1    NEVH01006721    PNF37230.1    NEVH01006980    PNF36330.1    KL367628    KFD61291.1    GBHO01033237    JAG10367.1    KL367553    KFD64618.1    GEZM01045163    GEZM01045162    JAV77888.1    JYDU01000001    KRY01876.1    LBMM01008999    LBMM01007721    KMQ88472.1    KMQ89488.1    KL367691    KFD60150.1    KRY26801.1    GAMC01020352    JAB86203.1    GAMC01008189    JAB98366.1    JYDL01000068    KRX18751.1    AAZX01000499    CM003610    KYP61490.1    X13777    KL367480    KFD71809.1    KQ483989    KYP38573.1    KL367527    KFD66146.1    GGFL01004951    MBW69129.1    GGFM01000952    MBW21703.1    GGFM01000953    MBW21704.1    GFTR01008771    JAW07655.1    GEFH01000951    JAP67630.1    GDHF01029905    JAI22409.1    GDHF01000873    JAI51441.1    GBXI01017107    JAC97184.1    NCKU01012701    RWS00004.1    FJ544857    ACL97387.1    CM003608    KYP66486.1    JYDP01000258    KRZ01816.1    OIVN01006239    SPD28653.1    GBHO01020706    JAG22898.1    JYDO01000104    KRZ71003.1    GDHF01029191    JAI23123.1    KL367637    KFD61067.1    GDHF01029405    JAI22909.1    LBMM01008805    KMQ88628.1    OIVN01001269    SPC91982.1   
Pfam
PF13976   gag_pre-integrs        + More
PF07727   RVT_2
PF00665   rve
PF13961   DUF4219
PF00098   zf-CCHC
PF14244   Retrotran_gag_3
PF04500   FLYWCH
PF05380   Peptidase_A17
PF00078   RVT_1
PF05585   DUF1758
Interpro
IPR036397   RNaseH_sf        + More
IPR025724   GAG-pre-integrase_dom       
IPR001584   Integrase_cat-core       
IPR039537   Retrotran_Ty1/copia-like       
IPR013103   RVT_2       
IPR001878   Znf_CCHC       
IPR012337   RNaseH-like_sf       
IPR036875   Znf_CCHC_sf       
IPR025314   DUF4219       
IPR029472   Copia-like_N       
IPR007588   Znf_FLYWCH       
IPR008042   Retrotrans_Pao       
IPR000477   RT_dom       
IPR008737   Peptidase_asp_put       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
4NYF     E-value=0.031873,     Score=91

Ontologies

Topology

Length:
1080
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01138
Exp number, first 60 AAs:
0.00036
Total prob of N-in:
0.00017
outside
1  -  1080
 
 

Population Genetic Test Statistics

Pi
222.975141
Theta
126.062118
Tajima's D
2.647468
CLR
1.224487
CSRT
0.955602219889006
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号