SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15497  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010761
Annotation
PREDICTED:_ABC_transporter_G_family_member_23_isoform_X2_[Amyelois_transitella]
Location in the cell
PlasmaMembrane   Reliability : 4.706
 

Sequence

CDS
ATGACCGTCGCTAAAGGCACCATATACGGTCTACTTGGTGCGTCGGGCTGTGGGAAGACCACGCTTCTGTCTTGCATCGTGGGCAGACGGAAATTAAACAGCGGCGAGATATGGGTGCTCGGAGGGAAGCCTGGAACAAAAGGGTCTGGTGTCCCCGGGAAACGCGTCGGCTACATGCCTCAGGAGATAGCTCTGTACGGAGAGTTCACCATCAAGGAGACCATGATGTATTTCGGCTGGATCTTCGGCATGGAGACGAAGGAGATCGTGGATCGTCTTCGGTTCCTGCTAGACTTTCTGGACCTGCCCAGCGAGAACCGAATGGTCAAGAACTTGAGTGGAGGGCAGCAGAGAAGAGTCTCGTTCGCTGTAGCGCTGATGCACGACCCCGAACTCCTGATCTTGGACGAGCCGACGGTCGGAGTGGATCCACTGCTGAGGCAGTCGATCTGGACCCATTTGGTTCGGATCACCAGCTCCGGAGACAAGACCGTTATTATCACCACTCATTATATTGAGGAGGCCAGGCAGGCGCACTGCATTGGTCTGATGAGGAGCGGTCGTCTCCTCGCCGAGGAGTCCCCACAGGCCTTACTTAGAATGTACAGCTGCATATCGTTGGAAGATGTCTTCCTAAAACTATCCAGAAAACAGGGTCAATCGAATCAAGTAGTGGAACTAAACGTGACCGGCGGAGGAGCCCTCGGTCTGAACAAGATGTGTAAGCGCGAGGAGGCGCCCTACGCGGCCGAGGACGGGCAGGTCGTGGGCCTGAACTTCCACCAGTCCAAGGAGGTGCTCATTGTAGACCACGGAGCTGGGTCTAACGGAGACATTCCCGGTAAAGTCACGGAGGTCGTGGCCGCGGAGTGCGAAGACTGCGGGAATTGTTTCAATCTGACGTCGAGAGGGAAGATAAAAGCGTTGATCCAGAAGAACTTCCTGCGCATGTGGAGGAACATCGGCGTGATGCTGTTCATCTTCGTTCTCCCAGTGATGCAAGTCATTCTCTTCTGTCTGGCCATCGGAAGGGATCCGACAGGACTACGGATCGCCGTAGTCAACGAAGACGTGAGGATAATAGACGGCGACTGTCCCTACAACCACACCTGCTCAATGAAGAACCTCTCCTGCCGATACCTGGACAACCTGAGCGACCACATGATAAAGGAGTACTACGCTGATCTGTCGTCAGCGCTGGATGCCGTCCGTCAGGGTGAAGCCTGGGGCGCTCTGTACTTCAATGAGAATTATACGGATTCTTTGGTCGCCAGATTGGCTCTGGCTGACACGGCCGACGAAGAGACGGTGACATCGTCCGAGGTTCAAGTCTGGCTAGACATGTCCAACCAGCAGATCGGACTTATGCTCAACCGGGACATACAGTTCTCGTACAGGGACTTCGCTAAGGGTCTGCTTGAGACGTGCGACTACAACCCGAAGCTGGGCGACATCCCGATCGACTTCATGGACCCCATATACGGGAATAAGAACCCTTCGTTCACAGACTTCGTAGCTCCCGGCGTCATATTAACCATCGTATTCTTCCTCGCCGTGGCCCTGACATCGTCAGCGTTGATCGTGGAACGGATGGAGGGCCTCCTGGACCGATCCTGGGTGGCAGGGGTGTCTCCCGGAGAGATTCTGTTCTCGCACGTCGTCACCCAGTTCGTGGTGATGTGCGGGCAGACGGCGCTGGTGCTCATCTTCATGATATCGGTGTTCGGCGTCAAGAATAATGGGAACATCGTCTTCGTTATCATGCTGACTTTGCTGCAAGGTCTGTGCGGCATGTGCTTCGGGTTCGTGATATCGGCCGCTTGCGAGCTAGAGCGGAACGCGATCCAGCTGGCCTTGGGTTCGTTCTACCCCACGCTGCTGCTGAGCGGGGTGATCTGGCCCATCGAAGGGATGCCCTGGATCCTGCGCTACGTGTCCCTCTGCCTGCCCCTCACCCTCGCCACGAACTCGCTGCGGTCCATCCTGACGCGGGGCTGGCCCTTCACGGACTCGGACGTGTACATGGGCTTCGTGTCGACGTTGGCCTGGATCGCGCTCTTCCTCATCGTAACCCTCACGATCCTGAAATTCAAACGGAATTAA
Protein
MTVAKGTIYGLLGASGCGKTTLLSCIVGRRKLNSGEIWVLGGKPGTKGSGVPGKRVGYMPQEIALYGEFTIKETMMYFGWIFGMETKEIVDRLRFLLDFLDLPSENRMVKNLSGGQQRRVSFAVALMHDPELLILDEPTVGVDPLLRQSIWTHLVRITSSGDKTVIITTHYIEEARQAHCIGLMRSGRLLAEESPQALLRMYSCISLEDVFLKLSRKQGQSNQVVELNVTGGGALGLNKMCKREEAPYAAEDGQVVGLNFHQSKEVLIVDHGAGSNGDIPGKVTEVVAAECEDCGNCFNLTSRGKIKALIQKNFLRMWRNIGVMLFIFVLPVMQVILFCLAIGRDPTGLRIAVVNEDVRIIDGDCPYNHTCSMKNLSCRYLDNLSDHMIKEYYADLSSALDAVRQGEAWGALYFNENYTDSLVARLALADTADEETVTSSEVQVWLDMSNQQIGLMLNRDIQFSYRDFAKGLLETCDYNPKLGDIPIDFMDPIYGNKNPSFTDFVAPGVILTIVFFLAVALTSSALIVERMEGLLDRSWVAGVSPGEILFSHVVTQFVVMCGQTALVLIFMISVFGVKNNGNIVFVIMLTLLQGLCGMCFGFVISAACELERNAIQLALGSFYPTLLLSGVIWPIEGMPWILRYVSLCLPLTLATNSLRSILTRGWPFTDSDVYMGFVSTLAWIALFLIVTLTILKFKRN

Summary

EMBL
KZ149908    PZC78206.1    NWSH01002444    PCG68290.1    KQ461003    KPJ10017.1    + More
AGBW02007729    OWR54659.1    KP260785    AKC96438.1    BABH01016552    BABH01016553    KQ459601    KPI93659.1    GAPW01000273    JAC13325.1    CH477332    EAT43312.1    ATLV01012278    KE524778    KFB36382.1    AXCN02001185    AAAB01008888    EAA08957.4    GGFL01004874    MBW69052.1    APCN01003191    AXCM01005332    GGFK01010093    MBW43414.1    CVRI01000064    CRL05114.1    DS231874    EDS41694.1    GFDL01005796    JAV29249.1    GFDL01005797    JAV29248.1    NNAY01000487    OXU28050.1    GFDF01002652    JAV11432.1    UFQS01000026    UFQT01000026    SSW97683.1    SSX18069.1    AJWK01018516    AJWK01018517    AJWK01018518    GL766597    EFZ14974.1    KQ977104    KYN05824.1    KQ434803    KZC06014.1    GBHO01010337    GBHO01009451    GBRD01007340    GDHC01014585    JAG33267.1    JAG34153.1    JAG58481.1    JAQ04044.1    ADTU01000145    ADTU01000146    ADTU01000147    ADTU01000148    ADTU01000149    GL888102    EGI67545.1    KQ983238    KYQ46326.1    GBHO01016100    GBHO01010341    JAG27504.1    JAG33263.1    KQ980956    KYN11092.1    KQ981606    KYN39654.1    GBYB01005060    GBYB01005062    GBYB01005063    GBYB01005147    JAG74827.1    JAG74829.1    JAG74830.1    JAG74914.1    KK107203    EZA55461.1    QOIP01000002    RLU25698.1    KK852498    KDR22698.1    DS235035    EEB10801.1    KQ414688    KOC63687.1    GFXV01005297    MBW17102.1    GECU01035592    GECU01019890    JAS72114.1    JAS87816.1    GEBQ01009237    JAT30740.1    KQ767877    OAD53261.1    KP343867    AKJ85499.1    GEBQ01007609    JAT32368.1    GL451937    EFN78194.1    KF828806    AIN44123.1    ABLF02035201    ABLF02035202    KQ971372    KYB25372.1    GEZM01003527    JAV96755.1    GEZM01003528    JAV96754.1    KY792990    ASC49547.1    KYB25373.1    GEDC01014139    JAS23159.1    GANO01000296    JAB59575.1    CH933806    EDW16431.1    KRG02121.1    KRG02123.1    KRG02120.1    CH940650    KRF83319.1    CH902617    EDV43625.1    KPU80390.1    KPU80391.1    EDW67505.1    CH916377    EDV90490.1    KRG02119.1    KRG02122.1    GAKP01018587    JAC40365.1    CH964232    EDW81502.1    KRF99463.1    CH480819    EDW53265.1    GAMC01020938    JAB85617.1    GAMC01020936    JAB85619.1    GDHF01018144    GDHF01013480    JAI34170.1    JAI38834.1    OUUW01000005    SPP80794.1    CH954182    EDV53311.1    GAKP01018589    JAC40363.1    CM000160    EDW98396.1    KRK04251.1    CM000070    EIM52351.2    KRK04249.1    CP012526    ALC47216.1    ADMH02001506    ETN62261.1   
Pfam
PF01061   ABC2_membrane        + More
PF00005   ABC_tran
PF07703   A2M_BRD
PF07677   A2M_recep
PF00207   A2M
PF01835   MG2
PF17791   MG3
PF07678   TED_complement
Interpro
IPR013525   ABC_2_trans        + More
IPR003593   AAA+_ATPase       
IPR017871   ABC_transporter_CS       
IPR003439   ABC_transporter-like       
IPR027417   P-loop_NTPase       
IPR000412   ABC_2_transport       
IPR011626   Alpha-macroglobulin_TED       
IPR036595   A-macroglobulin_rcpt-bd_sf       
IPR008930   Terpenoid_cyclase/PrenylTrfase       
IPR041555   MG3       
IPR013783   Ig-like_fold       
IPR019742   MacrogloblnA2_CS       
IPR002890   MG2       
IPR041813   A2M_TED       
IPR011625   A2M_N_BRD       
IPR001599   Macroglobln_a2       
IPR009048   A-macroglobulin_rcpt-bd       
IPR016024   ARM-type_fold       
IPR028426   Huntingtin_fam       
SUPFAM
SSF52540   SSF52540        + More
SSF49410   SSF49410       
SSF48239   SSF48239       
SSF48371   SSF48371       
Gene 3D
PDB
4YER     E-value=2.70383e-25,     Score=289

Ontologies

Topology

Length:
700
Number of predicted TMHs:
7
Exp number of AAs in TMHs:
156.26475
Exp number, first 60 AAs:
0.689219999999999
Total prob of N-in:
0.05328
outside
1  -  320
TMhelix
321  -  343
inside
344  -  503
TMhelix
504  -  526
outside
527  -  552
TMhelix
553  -  575
inside
576  -  581
TMhelix
582  -  604
outside
605  -  613
TMhelix
614  -  633
inside
634  -  639
TMhelix
640  -  658
outside
659  -  672
TMhelix
673  -  695
inside
696  -  700
 
 

Population Genetic Test Statistics

Pi
213.615896
Theta
151.104674
Tajima's D
0.853309
CLR
0.256797
CSRT
0.615569221538923
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号