SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15494
Annotation
S33901_reverse_transcriptase_-_silkworm_transposon_Pao
Location in the cell
Mitochondrial   Reliability : 2.227
 

Sequence

CDS
ATGGATGCGCTATGCATCACACCAAGAAAACCAAAAACAGACCCAGAGGAACAGGCGCTTCGCATCCTCAACAGCAATACAGTCCACACAACAGATGGAAGATACGAAACTGCTCTGCTCTGGAAAACAGATAATGTCAGTCTACCAGACAACTACAATAACTCGTTAAAGCGACTGATAAATATAGAAAACAAACTCGATCGTAATCCGGAACTGAAACAGATATACACAGAACAGATGGAATCACTCGTCACGAAAGGCTACGCCGAGCTCGCTCCAAAAACAAAAACAGAGAACAGAACGTGGTATCTACCTCACTTCGCCGTCGTGAACCCCCTGAATCCGGAAAAACTCCGAGTCGTCCACGACGCCGCCGCCAAAACAAGAGGGGTAGCTTTAAATGATATGCTGCTTAAGGGACCGGACCTACTCCAATCACTACCAGGAGTGATAATGCGATTTAGACAGCATAATATAGCAGTAACAGCAAACATCAAGGAGATGTTCATGCAAGTGAAATTGAGACACGAAGACAGAGACGCGCTCCGATATCCCTGGCGCAAAGATCGCCGAGATGACAAGCCCCCAGAAGAATACAGAATGACCTCGTTGATCTTCGGTGCGTCAAGTTCTCCTTCCACAGCAATATATGTAAAGAACTTGAACACCCAGAAACAAGAAGCCACGCACCCGGAGGCGGCAGTCGCAGTACAGAACAGACACTACGTAGACGACTTCTACTTGGATAACTTCAAAACTTTAAAAGATGCAGTGCACATAACTACAGAGTTTCATCGAAAACACGAAAGAAAGCCGACCTCGAAGACCTTCTGGACCGACAGTAAGATAGTGTTGAGATGGACAAGAACGGGATCACGCTCGAACAAACCATACGTCGCCCAACGCCTGACAGCTATAGAAGACAGTGCAACAGTAAACGGGAGGCGATGGTTACCCACGAAGCATAACTTAGCCGACGACGTGACCCGAGACGTCCCAATGCCGTACCGCAACGAACATAGGTGGTTCAGAGGGCCAGAATTCCTACGCCAACGAGAGGACCCCTGGCCGACGGAATCGGCGTCAGAAACTACAGAACCGATGGGTGAAGTAAATATAGCAGCTGCAGCACCGGCGGGAGCTTCATGGCCGAAGCGTCCCGACAACGTGGGGCGCATCGTAGACTTCAGAACCAAGGGTGGAGTTCTACGAAGACCAGTACGAAAACTACTGATCCTGCCCATCGAAGAAGACCATCCTGCACCGAAAAGAATGCGACTGACTCGCACGGCGGGAGTAATGTGCAGGACGAAATAG
Protein
MDALCITPRKPKTDPEEQALRILNSNTVHTTDGRYETALLWKTDNVSLPDNYNNSLKRLINIENKLDRNPELKQIYTEQMESLVTKGYAELAPKTKTENRTWYLPHFAVVNPLNPEKLRVVHDAAAKTRGVALNDMLLKGPDLLQSLPGVIMRFRQHNIAVTANIKEMFMQVKLRHEDRDALRYPWRKDRRDDKPPEEYRMTSLIFGASSSPSTAIYVKNLNTQKQEATHPEAAVAVQNRHYVDDFYLDNFKTLKDAVHITTEFHRKHERKPTSKTFWTDSKIVLRWTRTGSRSNKPYVAQRLTAIEDSATVNGRRWLPTKHNLADDVTRDVPMPYRNEHRWFRGPEFLRQREDPWPTESASETTEPMGEVNIAAAAPAGASWPKRPDNVGRIVDFRTKGGVLRRPVRKLLILPIEEDHPAPKRMRLTRTAGVMCRTK

Summary

Pfam
PF03564   DUF1759        + More
PF05380   Peptidase_A17
PF18701   DUF5641
PF00665   rve
PF05585   DUF1758
PF17921   Integrase_H2C2
PF00628   PHD
PF00078   RVT_1
Interpro
IPR005312   DUF1759        + More
IPR001878   Znf_CCHC       
IPR008042   Retrotrans_Pao       
IPR040676   DUF5641       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR041588   Integrase_H2C2       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR000253   FHA_dom       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF57903   SSF57903       
SSF57756   SSF57756       
Gene 3D

Ontologies

Topology

Length:
438
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0032
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01459
outside
1  -  438
 
 

Population Genetic Test Statistics

Pi
33.028939
Theta
57.056426
Tajima's D
0.730084
CLR
0.235755
CSRT
0.585370731463427
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号