SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15491  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010787
Annotation
putative_Rho-associated_protein_kinase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 3.009
 

Sequence

CDS
ATGTATTCTGGCGGAGGCGGAGCGGAAGCTGTCGGAGCTGGAGCGCAGGGGGGGCGGCGCTCGACCCTCATGTCGCGGATCAACTACTTCGAGAACGCGGGCGGAGACAGGAGGGACGTGCAGAGGGAAACAAGAGAACTTCAAGAAGTCAAAGAAGTGGCCGAAGTTGTAGAGATGAGACAAGAAGTCGCGGAAGTCACCGAGCCCTCAGGTTCAGCAGTATCTGCGCGTCCCCCCTCGCCGCCCGCTGTTCCAGAAGTGGCTGAACGTGCCCCCTCGCCGGTCGCGCCCTCCGCTCCCCCCGCCCCGCCGACACAGCTCCCCCCGCCGCCGCCTCCCCCCCCTCCCCCTCCACCGCCCCCGGCAGTGTTCAACGCAGGGCCGACTGAAGACATGGCCAAAATGCTGTCAAACAAACAGGGAACTCTGAAGAGAAGCAAGCAGAACAATGGTGGCGCAATCGACGCTATAGTGGACCAAATCAAAGGAGGGAAATTCCAATTAAAGTCAACCGACCAGAACTTCCTCGAGCGAAAACCCAAAGACGACCAGCCAGAAGCTGTCAAGGAAATGCTGGCCATCCTCGGAACGCTGAGGAAGAGACGCAACGTGAACCGGCCCTGCTTCGTGGCCGGCGCGGAGAAGCACGGCGACGACAGCCTCACGTAA
Protein
MYSGGGGAEAVGAGAQGGRRSTLMSRINYFENAGGDRRDVQRETRELQEVKEVAEVVEMRQEVAEVTEPSGSAVSARPPSPPAVPEVAERAPSPVAPSAPPAPPTQLPPPPPPPPPPPPPPAVFNAGPTEDMAKMLSNKQGTLKRSKQNNGGAIDAIVDQIKGGKFQLKSTDQNFLERKPKDDQPEAVKEMLAILGTLRKRRNVNRPCFVAGAEKHGDDSLT

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
222
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00037
Exp number, first 60 AAs:
0.00037
Total prob of N-in:
0.02268
outside
1  -  222
 
 

Population Genetic Test Statistics

Pi
85.151113
Theta
116.951561
Tajima's D
-0.68259
CLR
180.632349
CSRT
0.202889855507225
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号