SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15490  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA010764
Annotation
PREDICTED:_aminopeptidase_N_[Bombyx_mori]
Full name
Aminopeptidase      
Location in the cell
Mitochondrial   Reliability : 1.777
 

Sequence

CDS
ATGGGCTCCAGTAACCACTTAACACCAGCACCTTATCGCGTCAATTATGATGCTCGTAACTGGGAACTTCTTTCGGAGACACTGCTCAGCGACAAGTACGATGAGATCCCAGTACTGGGCAGAGTGCAACTGATATCGGACGCCTTCGCTCTGGCGGCCACCAACAGACTCAACTATTCCACTACACTGATTCTTGCAAGCTACCTCCAGAGAGAGAGGGAGTACCTGCCTCTGTCGACAGCGCTGAGAGGGTTGGCCAAGATTGAGAACCTCTTGAAGCGCAGCGGAGACTACAGCGCCTTCCAGAGCTACATCAGGCATCTGGTGCAGAACTCGTATCGAAGGGCTGGAGGCCTCTCCGTCAAGCGTATCGTTAATGGCGACGATCTGAACAGCGTAAAACTGCAGGTGTTGACCAGCGGCTGGGCCTGTCGCGCGCTGATACCGGGCTGCGAGGAAAACGCCATGGAGCTGTTCCAAATGTGGATGAACACTTCCAATCCGGATGAAAATAATCCGCAAGTTTTCTTTATTTTTTCATCTAAGGACACGATCGATGGGGATCACAAGTCGATGTCTCAATTTAAAACGACCCGCGCGGGGATGAAGATCCCGCTGGACCTGCGGCGCACGGTGTGGTGCGCGGGCGCGGCGCGCGGCGGCGAGCGCGAGTGGCGCTTCCTCACGCTGCGGCTGCAGGCCGCGCGCGTTGCCGCCGCCCGCGACGCCATGCTCGCCGCCATGGCCTGCACCAGGCAGGTCTGGCTGCTCAACCAGTTCCTCGAATGGGCGGTGTCGGAGAACTCCCCGGTGCGCAAGCAGGACGCGGCCGCCGTGGTCGGTAACGTGGCCCGCACGCCGGTCGGCTACTACGTCGCGCGGGAGTTCTTCTACAACCGAATCGACGATCTGTTTAAGACTTTCAACGGTCAGAGCCGCCGTTTCGGCTATATCATCAAGACTCTGCTGGACCAGTTCACGACTCAGAGAGAATTGGACGAGTTTCTCATTTTCCACGACAAGAACCCTAAATATTTCGAGGAGACGAAGCTGGCCGTCGTTCAGGCGATTGAGAAAGCCAAAGTGAACATCGACTGGGTCGACCAAAACAAAGATTTAGTTATGAGTGAATAA
Protein
MGSSNHLTPAPYRVNYDARNWELLSETLLSDKYDEIPVLGRVQLISDAFALAATNRLNYSTTLILASYLQREREYLPLSTALRGLAKIENLLKRSGDYSAFQSYIRHLVQNSYRRAGGLSVKRIVNGDDLNSVKLQVLTSGWACRALIPGCEENAMELFQMWMNTSNPDENNPQVFFIFSSKDTIDGDHKSMSQFKTTRAGMKIPLDLRRTVWCAGAARGGEREWRFLTLRLQAARVAAARDAMLAAMACTRQVWLLNQFLEWAVSENSPVRKQDAAAVVGNVARTPVGYYVAREFFYNRIDDLFKTFNGQSRRFGYIIKTLLDQFTTQRELDEFLIFHDKNPKYFEETKLAVVQAIEKAKVNIDWVDQNKDLVMSE

Summary

Cofactor
Zn(2+)
Similarity
Belongs to the peptidase M1 family.
Feature
chain  Aminopeptidase
EC Number
3.4.11.-
EMBL
BABH01016541    BABH01016542    JQ061154    AFK85028.1    KZ149908    PZC78228.1    + More
MF319742    ASJ26456.1    KQ461003    KPJ10021.1    AGBW02011488    OWR46566.1    AGBW02009182    OWR51448.1    KQ459601    KPI93655.1    NWSH01000721    PCG74619.1    JTDY01002793    KOB70714.1    DS235745    EEB16222.1    KC282398    AGX25155.1    KQ971311    EEZ99336.1    APGK01004410    KB735736    ENN83310.1    UFQS01000417    UFQT01000417    SSX03766.1    SSX24131.1    GANO01002430    JAB57441.1    KU932234    APA33870.1    MF741655    AVD96938.1    KB632093    ERL88678.1    GECU01035837    JAS71869.1    ABLF02020107    SSX03765.1    SSX24130.1    GGMR01010385    MBY23004.1    GEDC01016064    JAS21234.1    APGK01027780    APGK01027781    APGK01027782    APGK01027783    APGK01027784    APGK01027785    KB740671    ENN79629.1    GEZM01046358    GEZM01046357    JAV77303.1    AXCN02001411    ATLV01021848    KE525324    KFB46929.1    CVRI01000060    CRL03858.1    CRL03857.1    GBXI01008343    JAD05949.1    GEBQ01009689    JAT30288.1    ABLF02020109    GEBQ01015299    JAT24678.1    GAMD01001656    JAA99934.1    GFXV01004127    MBW15932.1    ADMH02001160    ETN63860.1    GAKP01019737    JAC39215.1    GDHF01016887    JAI35427.1    GDHF01029538    JAI22776.1    GAKP01019736    JAC39216.1    JXUM01080917    KQ563216    KXJ74267.1    AAAB01008963    EAA12046.5    GAMC01009092    JAB97463.1    GBBI01003749    JAC14963.1    GDKW01002163    JAI54432.1    ACPB03023190    CP026247    AWP01958.1    AE014297    AAF56882.2    CH916377    EDV90757.1    AXCM01001470    GFTR01008270    JAW08156.1    CM000364    EDX14830.1    GBGD01000392    JAC88497.1    GECL01003570    JAP02554.1    CH933806    KRG01998.1    EDW16218.2    CH902623    EDV30519.1    NNAY01001852    OXU22728.1    KQ760397    OAD60666.1    EDV30518.1    LJIJ01000073    ODN03435.1    AY051855    AAK93279.1    CM000070    EAL26872.1    CH479186    EDW39068.1    JRES01001565    KNC22036.1    AF231040    AAF34809.1    GL440629    EFN65601.1    CM000160    EDW98315.1    BT133378    AAF56884.1    AFH36363.1    CH954182    EDV53234.1    EDX14833.1    BT014634    AAT27258.1    CH480819    EDW53344.1    EDX14831.1    EDW98314.1    EDW98311.1    EDV53237.1    EDV53235.1    EDW98312.1    KRK04210.1    KRK04208.1   
Pfam
PF11838   ERAP1_C        + More
PF01433   Peptidase_M1
PF01529   DHHC
Interpro
IPR024571   ERAP1-like_C_dom        + More
IPR042097   Aminopeptidase_N-like_N       
IPR014782   Peptidase_M1_dom       
IPR034016   M1_APN-typ       
IPR001930   Peptidase_M1       
IPR027268   Peptidase_M4/M1_CTD_sf       
IPR001594   Palmitoyltrfase_DHHC       
IPR033581   APN2       
Gene 3D
PDB
5LDS     E-value=2.06968e-35,     Score=373

Ontologies

Topology

Length:
377
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01123
Exp number, first 60 AAs:
0.00477
Total prob of N-in:
0.00502
outside
1  -  377
 
 

Population Genetic Test Statistics

Pi
69.369457
Theta
139.979595
Tajima's D
-0.630956
CLR
210.486009
CSRT
0.217789110544473
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号