SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15488
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.842
 

Sequence

CDS
ATGTACCGGGGGTCGGTTCTCGGCCCCCTCTTGTGGAATATCGGGTACGACTGGGTGCTGAGGGGCGCCCTCCTCCCGGGCCTCCGCGTTATTTGTTACGCGGACGACACGTTGGTCGTGGCCCGGGGTCATGATTTTAGGGAGTCTGCCCGTCTCGCCACAGCGGGAGTGGCCCTCGTCGTCGGAAGGATAAGGAGTCTGGGTCTCGACGTGGCGCTCAGTAAATCCGAGGCTCTGTGGTTTCACGGGCCGCGGAGGGCGCCACCAGTTGACACCCACATCGTGGTTGGAGGCGTCCGGATAGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCGTGTTGGACAGCCGGTGGGCTTTTCGTGCTCACTTTGCGGAGCTGGTCCCCCGATTGATGGGGACGGCCGGTTCTTTGAGCCGGCTGCTCCCGAATATTGGGGGACCGGATCAGGTTGTGCGCCGCCTCTACGCGGGGGTGGTGCGATCGATGGCCCTGTACGGTGCACCTGTGTGGGCTGAGCCGCGCAACCGGGCCACTATGGCTCGGTTCCTGCGCCGGCCGCAGCGCACCGTTGCCATCAGGGTCATCCGCGGATATCGCACCGTCTCCTTCGAGGCGGCGTGTGTTTTGGCGGGGACGCCGCCATGGGAGCTGGAGGCGGAGTCGCTCGCTGCCGACTATCGGTGGCGCAGCGAGCTCCGTGCTCGGGGCGTGGCGCGTGTCCCCGATAGTGAGCTGCGGGCGCGGAAGGCCCATTCTCGGCGGTCCGTGCTCGAGTCGTGGTCGAGGCGATTGGCCAACCCCACGTGGGGGCTACGGACCATCGAGGCGGTTTACCCGGTCTTTGATGACTGGGTGAATCGTGGCGAGGGACGTCTCACCTTTCGTCTGGTGCAGGTGCTGACCGGGCACGGATGCTTCGGGAAGTACCTGCGCCGGATAGGGGCTGAGCCGACGACGAGGTGTAACCATTGTGGACACGACCTGGACACGGCGGAGCATACGCTCGCTGTCTGCCCCGCTTGGGAGGTGCAGCGCCGTGTCCTGGTCGCAAAGATAGGACCTGACTTGTCGCTGCCTGGCGTCGTGGCGTCGATGCTTGGCAGCGATGAGTCATGGAAGGCTATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGAGTGAGGGAAAGCTCTCCTCACTACGCAGAAACCCGCCGCCGCCGAGCAGGGGGTCGGGACCGGGGTCGTATCCGTGACCTGGCCCCCTAA
Protein
MYRGSVLGPLLWNIGYDWVLRGALLPGLRVICYADDTLVVARGHDFRESARLATAGVALVVGRIRSLGLDVALSKSEALWFHGPRRAPPVDTHIVVGGVRIGVGVQLKYLGLVLDSRWAFRAHFAELVPRLMGTAGSLSRLLPNIGGPDQVVRRLYAGVVRSMALYGAPVWAEPRNRATMARFLRRPQRTVAIRVIRGYRTVSFEAACVLAGTPPWELEAESLAADYRWRSELRARGVARVPDSELRARKAHSRRSVLESWSRRLANPTWGLRTIEAVYPVFDDWVNRGEGRLTFRLVQVLTGHGCFGKYLRRIGAEPTTRCNHCGHDLDTAEHTLAVCPAWEVQRRVLVAKIGPDLSLPGVVASMLGSDESWKAMLDFCECTISQKEAAGRVRESSPHYAETRRRRAGGRDRGRIRDLAP

Summary

EMBL
AB090825    BAC57926.1    KZ150386    PZC71062.1    AB078935    BAC06462.1    + More
AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    RSAL01000481    RVE41577.1    LBMM01012027    KMQ86470.1    D85594    BAA19776.1    KZ150308    PZC71477.1    LBMM01019839    KMQ83438.1    KQ460685    KPJ12887.1    LBMM01019838    KMQ83439.1    LBMM01004272    KMQ92618.1    LBMM01006954    KMQ90166.1    LBMM01008861    KMQ88580.1    LBMM01024063    KMQ82623.1    LBMM01014132    KMQ85305.1    LBMM01006671    KMQ90407.1    LBMM01006657    KMQ90417.1    LBMM01008682    KMQ88705.1    LBMM01007036    KMQ90099.1    LBMM01006725    KMQ90373.1    QOIP01000031    RLU14697.1    QOIP01000010    RLU18098.1    LBMM01002052    KMQ95336.1    LBMM01005733    KMQ91252.1    GL450953    EFN80213.1    RSAL01003504    RVE40273.1    LBMM01006063    KMQ90967.1    LBMM01007659    KMQ89538.1    LBMM01009738    KMQ87908.1    LBMM01004634    KMQ92224.1    LBMM01014956    KMQ84982.1    LBMM01015018    KMQ84954.1    LBMM01002480    KMQ94776.1    LBMM01005948    KMQ91066.1    LBMM01021647    KMQ83033.1    LBMM01004697    KMQ92167.1    LBMM01003245    KMQ93755.1    LBMM01008448    KMQ88867.1    LBMM01015025    KMQ84953.1    LBMM01003988    KMQ92922.1    LBMM01004505    KMQ92346.1    LBMM01005216    KMQ91703.1    LBMM01012412    KMQ86235.1    LBMM01007425    KMQ89740.1    LBMM01008278    KMQ89009.1    LBMM01006496    KMQ90570.1    LBMM01008422    KMQ88894.1    LBMM01005465    KMQ91492.1    LBMM01014122    KMQ85315.1    KMQ94772.1    LBMM01005474    KMQ91485.1    GECU01032129    JAS75577.1    LBMM01008349    KMQ88951.1    ABLF02011238    ABLF02005203    ABLF02041316    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    GGMR01004600    MBY17219.1    KQ971864    EFA13315.2    GGMR01000779    MBY13398.1    GGMR01015354    MBY27973.1    GGMR01019609    MBY32228.1    GFXV01001748    MBW13553.1    AB593321    BAK38639.1    KQ972691    KXZ75807.1    ABLF02014530    ABLF02018586    ABLF02058000    GFXV01002090    MBW13895.1    LBMM01012595    KMQ86127.1    ABLF02004597    ABLF02041324    GGMR01012534    MBY25153.1    ABLF02041886    KQ972544    KXZ75869.1    KXZ75806.1    GALX01004785    JAB63681.1    ABLF02004854    ABLF02041317    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GBXI01013438    JAD00854.1    ABLF02016435    ABLF02016436    ABLF02064751   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF01421   Reprolysin
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR024079   MetalloPept_cat_dom_sf       
IPR001590   Peptidase_M12B       
IPR000663   Natr_peptide       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
421
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.11166
Exp number, first 60 AAs:
0.08144
Total prob of N-in:
0.00517
outside
1  -  421
 
 

Population Genetic Test Statistics

Pi
0
Theta
0
Tajima's D
0
CLR
0
CSRT
0
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号