SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15472
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Mitochondrial   Reliability : 1.473 Nuclear   Reliability : 1.699
 

Sequence

CDS
ATGAAGCTCGGTCGCGCTCCCGATTCCGTTCCTGTCGCGAGGACTGTGGTGGATTGGCACACACTGGGCATTAGCCTGGCTGAATCTGATCCACCATCGCTCCCGTTTAGCTCGAACTCTACCCCGTCTCCTCAGGATACCGCTGAAGCCATAGACATCTTAACGTCACACATCACTTCGACATTAGATAGGTCATCAAAACAAGTTGTAGCGGAGGACTTCCTTTACCGCTTCGGGTTGCCCGACGATATTAGGGAGCTCCTTAGAGCTAAGAACGCCTCGATACGCGCCTACGACAGGTATCCTACCGCGGAAAATCGTATTCGAATGCGTGCCTTACAACGCGACGTAAGGTCTCGCATCGCCGAAGTCCGAGATGCCAGATGGTCTGATTTCTTAGAAGGACTCGCGCCCTCCCAAAGGTCTTACTACCGCTTAGCTCGTACTCTCAAATCGGATACGGTAGTAACTATGCCCCCCCTCGTAGGCCCCTCAGGCCGACTCGCGGCGTTCGATGATGACGAAAAAGCAGAGCTGCTGGCCGATACATTGCAAACCCAGTGCACGCCCAGCACTCAATCCGTGGACCCTGTTCATGTAGAATTAGTACACAGTGAGGTAGAACGCAGAGTCTCCTTGCCACCCTCGGATGCGTTACCACCCGTCACCCCGATGGAAGTTAAAGACTTGATCAAAGACCTACGTCCTCGCAAGGCTCCCGGTTCCGACGGTATATCCAACCGCGTTATTAAACTTCTACCCGTCCAACTCATCGTGATGTTGGCATCTATTTTCAATGCCGCTATGGCAAACTGTATCTTTCCCGCGGTGTGGAAAGAAGCGGACGTTATCGGCATACATAAACCCGGTAAACCAAAAAATCATCCGACGAGCTACCGCCCGATTAGCCTCCTCATGTCTCTAGGCAAACTGTATGAGCGTCTGCTCTACAAACGCCTCAGAGACTTCGTCTCATCCAAGGGCATTCTCATCGATGAACAATTCGGATTCCGTACAAATCACTCATGCGTTCAACAGGTGCACCGCCTCACGGAGCACATTCTTGTGGGGCTTAATCGACCAAAACCGTTATACACGGGAGCTCTCTTCTTCGACGTCGCAAAAGCGTTCGACCAAGTCTGGCACAACGGTTTGATTTTCAAACTATTCAACATGGGCGTGCCGGATAGTCTCGTGCTCATCATACGGGACTTCTTGTCGAACCGCTCTTTTCGATATCGAGTCGAGGGAACCCGCTCCTCCCCACGATCTCTCACAGCTGGAGTCCCGCAAGGCTCTGTCCTCTCACCTCTCCTATTTAGCTTATTCGTTAACGATATTTCCCGGTCGCCGCCGACCCATTTAGCTTTATTCGCCGACGACACGACTGTTTACTATTCCAGTAGAAACAAGTCCCTAATCGCGAAGAAGCTTCAGAGCGCAGCCCTAGCCCTAGGACAGTGGTTCCGAAAATGGCGCATAGACATCAACCCAGCAAAAAGTACTGCGGTGCTATTTCAGAGGGGAAGCTCCACACGGATTTCCTCCCGGATTAGGAGGAGGAATCTCACACCCCCGATTACTCTCTTTAGACAGCCCATACCCTGGGCTAGGAAGGTCAAGTACCTGAGCGTTACCCTGGATGCATCGATGACATTCCGCCCGCATATAAAATCAGTCCGTGACCGTGCCGCGTTTATTCTCGGTAGACTCTACCCCATGATCTGTAAGCGGAGTAAAATGTCCCTTCGGAACAAGGTGACACTTTACAAAACTTTCATAAGGCCCGTCATGACTTACGCGAGTGTGGTGTTCGCTCACGCGGCCCGCACACACATAGACACCCTCCAATCCCTACAATCCCGCTTTTGCAGGTTAGCTGTCGGGGCTCCGTGGTTCGTGAGGAACGTTGACCTACACGACGACTTGGGCCTCGAAGCAATTCGGAAATACATGAAGTCAGCGTCGGAACGATACTTCGATAAGGCTATGCGTCATGATAATCGCCTTATCGTTACTCCCCGAATCCTGATCATGCAGGAGCCAGTCACCGTCGACGCCCTAGACACGTCCTTACGGATCCATCAGATCCAATAA
Protein
MKLGRAPDSVPVARTVVDWHTLGISLAESDPPSLPFSSNSTPSPQDTAEAIDILTSHITSTLDRSSKQVVAEDFLYRFGLPDDIRELLRAKNASIRAYDRYPTAENRIRMRALQRDVRSRIAEVRDARWSDFLEGLAPSQRSYYRLARTLKSDTVVTMPPLVGPSGRLAAFDDDEKAELLADTLQTQCTPSTQSVDPVHVELVHSEVERRVSLPPSDALPPVTPMEVKDLIKDLRPRKAPGSDGISNRVIKLLPVQLIVMLASIFNAAMANCIFPAVWKEADVIGIHKPGKPKNHPTSYRPISLLMSLGKLYERLLYKRLRDFVSSKGILIDEQFGFRTNHSCVQQVHRLTEHILVGLNRPKPLYTGALFFDVAKAFDQVWHNGLIFKLFNMGVPDSLVLIIRDFLSNRSFRYRVEGTRSSPRSLTAGVPQGSVLSPLLFSLFVNDISRSPPTHLALFADDTTVYYSSRNKSLIAKKLQSAALALGQWFRKWRIDINPAKSTAVLFQRGSSTRISSRIRRRNLTPPITLFRQPIPWARKVKYLSVTLDASMTFRPHIKSVRDRAAFILGRLYPMICKRSKMSLRNKVTLYKTFIRPVMTYASVVFAHAARTHIDTLQSLQSRFCRLAVGAPWFVRNVDLHDDLGLEAIRKYMKSASERYFDKAMRHDNRLIVTPRILIMQEPVTVDALDTSLRIHQIQ

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  Probable RNA-directed DNA polymerase from transposon BS
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
KQ459265    KPJ02064.1    AF081103    AAC72921.1    GEZM01008457    JAV94772.1    GALX01005299    JAB63167.1    KQ971729    KYB24751.1    KQ973342    KXZ75569.1    GALX01005359    JAB63107.1    GGMR01019198    MBY31817.1    ABLF02029306    ABLF02029314    ABLF02060138    ABLF02042518    ABLF02057746    GGMS01006359    MBY75562.1    GGMS01002955    MBY72158.1    GFXV01007093    MBW18898.1    RPOV01000134    RPJ78669.1    GBBI01004395    JAC14317.1    ABLF02008463    GFTR01008038    JAW08388.1    ABLF02003961    ABLF02059872    GGMR01018716    MBY31335.1    GGMS01017914    MBY87117.1    GGMR01003407    MBY16026.1    ABLF02008153    ABLF02008462    ABLF02008464    GGMR01000676    MBY13295.1    S59870    AAB26437.2    ABLF02033757    GBBI01004571    JAC14141.1    GBBI01001646    JAC17066.1    GGMS01000737    MBY69940.1    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    GBYB01008290    JAG78057.1    GEZM01053022    JAV74219.1    NEVH01006736    PNF36716.1    ABLF02021177    ABLF02027367    ABLF02066338    ABLF02034467    GFTR01008262    JAW08164.1    GGMS01008766    MBY77969.1    GFDF01007661    JAV06423.1    NEVH01006721    PNF37225.1    GGFJ01001858    MBW50999.1    GGFJ01001857    MBW50998.1    NEVH01026386    PNF14434.1    GGMS01002992    MBY72195.1    ABLF02041767    GEZM01084969    JAV60363.1    ABLF02024246    GBGD01000880    JAC88009.1    GGMS01017365    MBY86568.1    ABLF02028535    ABLF02028545    GBGD01000799    JAC88090.1    GFTR01008271    JAW08155.1    NEVH01000269    PNF43694.1    GFTR01008256    JAW08170.1    GFTR01008279    JAW08147.1    NEVH01020940    PNF20481.1    NWSH01000032    PCG80497.1    ABLF02020655    ABLF02039168    ABLF02061060    NEVH01020071    PNF21969.1    GFTR01008246    JAW08180.1    NEVH01022639    PNF18527.1    NEVH01010546    PNF32261.1    PCG80496.1    NEVH01023962    PNF17612.1    NEVH01003017    PNF40781.1    NEVH01007443    PNF35684.1    GEZM01074951    JAV64378.1    NEVH01018383    PNF23463.1    NEVH01021586    NEVH01006600    NEVH01002584    PNF19589.1    PNF37419.1    PNF41868.1    ABLF02037660    NEVH01017542    PNF24034.1    JXUM01241784    KQ635293    KXJ62492.1    GGFJ01002256    MBW51397.1    GFTR01008251    JAW08175.1    GBBI01001570    JAC17142.1    GFXV01002840    MBW14645.1    GGFJ01002257    MBW51398.1    GBGD01000881    JAC88008.1    LBMM01013518    KMQ85605.1    NEVH01001355    PNF42855.1    ABLF02040174    ABLF02040183    ABLF02055266    NEVH01005938    PNF38077.1    AY060438    AAL25477.1    LBMM01014395    KMQ85192.1    NEVH01021205    PNF19912.1    NEVH01007838    PNF34986.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
SUPFAM
SSF56219   SSF56219       
Gene 3D

Ontologies

Topology

Length:
698
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.73217000000001
Exp number, first 60 AAs:
0.00015
Total prob of N-in:
0.04111
outside
1  -  698
 
 

Population Genetic Test Statistics

Pi
0.731223
Theta
3.064452
Tajima's D
-1.721695
CLR
11.890764
CSRT
0.0299985000749962
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号