SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15470
Annotation
PREDICTED:_uncharacterized_protein_LOC105387375_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 1.791 Nuclear   Reliability : 1.467
 

Sequence

CDS
ATGAAGCCGGACAAGATTCGCATCGTGCACGATGCCGCTGCGAAGACTAGAGGGAAGAGCCTTAACGACTTCCTGCTCACCGGCCCGGACCTGCTGCAGTCTCTGCCTGGAGTGATGATGCGCTTCAGGCAGCACGCCGTCGCCGTCTCAGCGGACATCACAGAGATGTTCATGCAAATAGGCGTCCGAAGCGAGGACCGCGACGCGCTCCGGTACTTGTGGAGGGAGGACCCTTCACAGGAGCCTACAGAGTACCGGATGAAATCTATAATCTTTGGCGCGACAAGCTCACCCGCGACCGCCATCTACGTGAAGAACGCCAACGCGGAGAAGTACCGACTGCAGTACCCGGACGCCGCCGACGCAATCGTACGCAACCACTATATGGACGATTATCTGGGAAGTTACCGGACAAGCGAAGACGCGATCAGGATCGCAAATGAGGTGAGGGCAGTACACCGGCAAGGCCATTTCGAGTTACGAAAATGGACCTCGAACAACGAGGAGGTACGGTGCCACATGACCGACGAAGCCCCCCCTACAAGTGTGACGCTGTCCGATGGAACGGAAATAGAACGAGTACTTGGCCTGGTGTGGAGACCTGCTGAAGACGTCCTCGCCTTCAATCTGGACATGGCGCGAATCCCAAAAGAAGTCTTGGAGAGCAGCGCGCCTACGAAGAGACAGGCTCTGCGAATAATGATGTCCGTCTACGACCCCCAAGGCATCGCATCACCGGTCACTGTCGGAGCGAAGAAGATTCTGCAAGAGACGTGGCGCCGAGGGACGGCGTGGGACTCCCCCCTCGATGAAGACCTCTGCGCGATGTGGAGAGAGTGGATCGACCACTTAAGACGCCTGCGCGGCGTCTCAGTGCCGCGCTGCTATCCCGGCTACTCAGACGCCGCCAACCTCCAGCTCCACACATACGTAGACGCCAGTGAGTCCGCCTACGCCGCCGCGTTATACTGGCGCGCCGAAATGCCCGACGGGGAGATCAGGACCTCCCTCGTACTCGCCAAAGCCCGAGTCGCGCCCTTGAGACTCACCTCGATACCGCGCCTCGAGCTACAAGCTGCCGTGATGGGCAGCCGCATGGCCGCGGCTGTCACAGAGGAACACGACAGAAAACCAGACGCGAGAGTGTTCTGGACAGACAGCGCCACCGTATTGACCTGGCTACGAACGGGGTCGAGGTCGTATCGACCGTTCGTCGCTCACCGCATTGCAGCGGTAGAAGAGAACAGCACTGTGGAGGAATGGCGCTGGGTCCCCACGAAGGAAAATGTCGCCGACGACGCCACTAGAGAGCTACCCGTCGGCTTTGAAAGAAACCACCGCTGGTTCATAGGCCCGGAATACCTAAGACGGCATCCGGATGATTGGCCCGTACAACGGACTGCAAGAAGGGCAGAAGAGACGGGTGAAGAGAAGTGCGCAACGCTCGCCGTGAGCAGAGAGAGCCTCGGCGAAGCAATCCCGGACCCGAGACGCTTCTCCAAGTGGGAGAAGTACCTGCGTGCAACGGGGCGAATACTGCAATTCGTCGACCTATGCCGCAGAAGTCGCGAGCGCACTCATTACAAGAGGACCAGGCGGAACCCGCGTTCGGACCCGACGTGGGAGAAGAATAGAAAGAAGACGACTTCGAAGACCCCGCTGAACACACCGCGGACGCCAGAGCAAGCAGTCATTCAATGGAAGACTTTAGACGCCGACACGCTTCGACGCGCCGAGACGCTCATTTGGCGACAGAGCCAGCGGGCGGCCTTCGAGGAAGAGATTTTGACGCTCCAACGAGGGAAACAAGTATCCCCAGCGAGCCGACTGCGAAACTTGTCCGTAACTTACGCGGACGGGATATTGAAAATAAACGGACGCATCGGCAACATAGAGGGAGCTGACGTCATCACCTCGCCTCTCGTGCTAGACGGATCCCGACGCGAAACGAGACTGATGATAGACTTCATCCATAGAAAGATGCACCACGCCGGAACCGAAGCTACGATCGCCGAGTGCCGACAGTCGTACTGGGTCTTACGCCTACGCCCAGTGACACGGAGCGTAATCCACAATTGTCTTCCGTGTCGTATCCGCAAGGACACTCCACCGCGTCCAGCCACAGGCGACCACCCACCGAGCAGACTGGCACACCATCGGCGACCATTTACATACGTGGGCCTCGATTACTTCGGGCCCTATCAAGTTACCACCGGCAGAAGCACCCAGAAGCACTACGTGGCCATCTTCACATGTCTCACTACGCGTGCGGTGCATTTAGAACCGGCAGCGAGCCTCAGCACGGACTCAGCAGTGATGGCACTCCGGCGCATGATCGCGCGCCGGGGAGCTCCGACGGAGATATGGAGCGACAACGGCACCAATTTACGGGGTGCCGACAAGGAGCTGCGCCAAGCTTTGGACAAGGCGACCGAGCATGAAGCGAGCTTAAGGCTTATACAATGGCGCTTCATCCCACCGGGCGCGCCTTTCATGGGCGGCGCCTGGGAGAGAATGGTGCGGGCGGTAAAGGCCGCGCTCTCGGCCACGGAGCAGCCGAGGCACCCGACGCCCGAAATATTTCACACTCTGCTAGCGGAGGCAGAGTTCACAGTGAACAGCCGACCTCTCACTCACGTATCGGTGAGCTCCGACGATCCCGACCCTCTAACACCGAACCACTTCCTGCTGGGAGGCCCGGCGCGAGTCCCCGTGCCGGGCAAATTTGACGACGCCGACCTCATAGGGCGCGCACACTGGCGCGCAGCACAACGTCTGGCAGATGTGTTCTGGAGTCGCTGGCTCCGGGAGTACCTGCCCGACCTGCAGAACCGGCGGGAGCCCCACAGCCGCGGGCCCGCCCTGAAGATAGGCGACGTCGTGATAATAGCAGACGGAACGCTCCCACGGAACACCTGGCCACGTGGGATCATCCAGGAGGTTTACCCGGGGGCCGACGGCATCACTCGAGTGGTCGACGTGCGCACCGCCGGCGGTATATTGCGACGCCCGGCAAAGAAGATCATCGTGCTGCCCACGATGTCCGCCGCTCACCAAGGAGGATGCAGCGACGTGAACGACGCTGCACGGCGGGAGGATGTTCGCGACGGACATGAATAA
Protein
MKPDKIRIVHDAAAKTRGKSLNDFLLTGPDLLQSLPGVMMRFRQHAVAVSADITEMFMQIGVRSEDRDALRYLWREDPSQEPTEYRMKSIIFGATSSPATAIYVKNANAEKYRLQYPDAADAIVRNHYMDDYLGSYRTSEDAIRIANEVRAVHRQGHFELRKWTSNNEEVRCHMTDEAPPTSVTLSDGTEIERVLGLVWRPAEDVLAFNLDMARIPKEVLESSAPTKRQALRIMMSVYDPQGIASPVTVGAKKILQETWRRGTAWDSPLDEDLCAMWREWIDHLRRLRGVSVPRCYPGYSDAANLQLHTYVDASESAYAAALYWRAEMPDGEIRTSLVLAKARVAPLRLTSIPRLELQAAVMGSRMAAAVTEEHDRKPDARVFWTDSATVLTWLRTGSRSYRPFVAHRIAAVEENSTVEEWRWVPTKENVADDATRELPVGFERNHRWFIGPEYLRRHPDDWPVQRTARRAEETGEEKCATLAVSRESLGEAIPDPRRFSKWEKYLRATGRILQFVDLCRRSRERTHYKRTRRNPRSDPTWEKNRKKTTSKTPLNTPRTPEQAVIQWKTLDADTLRRAETLIWRQSQRAAFEEEILTLQRGKQVSPASRLRNLSVTYADGILKINGRIGNIEGADVITSPLVLDGSRRETRLMIDFIHRKMHHAGTEATIAECRQSYWVLRLRPVTRSVIHNCLPCRIRKDTPPRPATGDHPPSRLAHHRRPFTYVGLDYFGPYQVTTGRSTQKHYVAIFTCLTTRAVHLEPAASLSTDSAVMALRRMIARRGAPTEIWSDNGTNLRGADKELRQALDKATEHEASLRLIQWRFIPPGAPFMGGAWERMVRAVKAALSATEQPRHPTPEIFHTLLAEAEFTVNSRPLTHVSVSSDDPDPLTPNHFLLGGPARVPVPGKFDDADLIGRAHWRAAQRLADVFWSRWLREYLPDLQNRREPHSRGPALKIGDVVIIADGTLPRNTWPRGIIQEVYPGADGITRVVDVRTAGGILRRPAKKIIVLPTMSAAHQGGCSDVNDAARREDVRDGHE

Summary

EMBL
AB042118    BAA95569.1    AB042119    BAA95570.1    AF530470    AAQ09229.1    + More
KQ459986    KPJ18861.1    RSAL01000375    RVE42106.1    LNIX01000007    OXA52015.1    LNIX01000004    OXA55241.1    LNIX01000019    OXA44855.1    AAZX01023278    GDHC01018323    JAQ00306.1    LNIX01000015    OXA46575.1    JXUM01130316    KQ567562    KXJ69370.1    JXUM01127084    KQ567147    KXJ69602.1    LNIX01000039    OXA39294.1    GEZM01052586    JAV74401.1    JXUM01038372    KQ561162    KXJ79503.1    JXUM01136032    KQ568367    KXJ69026.1    GAMC01017930    JAB88625.1    JXUM01031097    KQ560909    KXJ80382.1    LNIX01000003    OXA57597.1    OXA56250.1    OXA56382.1    LN877231    CTR11689.1    GEHC01000913    JAV46732.1    GGFL01001682    MBW65860.1    GGFL01001842    MBW66020.1    GGFJ01000333    MBW49474.1    JXUM01111221    KQ565482    KXJ70922.1    GGFJ01000306    MBW49447.1    KL367480    KFD71819.1    AAGJ04043389    KL367687    KFD60188.1    GAMC01020598    GAMC01020596    GAMC01020592    JAB85959.1    NWSH01008670    PCG62455.1    GEHC01000967    JAV46678.1    GEHC01000945    JAV46700.1    OXA44812.1    AAGJ04091218    NSIT01000285    PJE78034.1    GAMC01020594    JAB85961.1    GGFL01005193    MBW69371.1    GEHC01000947    JAV46698.1    GDIP01036233    JAM67482.1    GDIP01004568    JAM99147.1    GGFK01006929    MBW40250.1    AAGJ04095911    AAGJ04058558    KL367508    KFD68106.1    AB110069    BAD01590.1    BAD01589.1    GDIQ01002920    JAN91817.1    GCES01111900    JAQ74422.1    GDIQ01002921    JAN91816.1    GEHC01000914    JAV46731.1    JXUM01009840    KQ560293    KXJ83223.1    GCES01095441    JAQ90881.1    ODYU01003174    SOQ41584.1    JXUM01144298    KQ569759    KXJ68523.1    GCES01137016    JAQ49306.1    JXUM01083542    KQ563383    KXJ73941.1    AAGJ04005692    AAGJ04017771    GCES01148192    JAQ38130.1    GGFJ01000487    MBW49628.1    GGFJ01000471    MBW49612.1    GGFJ01000470    MBW49611.1    GGMS01004301    MBY73504.1    GGFJ01000432    MBW49573.1    GCES01130050    JAQ56272.1    RCHS01003537    RMX41025.1    AAGJ04010560    AAGJ04094839    AJWK01027898    JXUM01013493    KQ560378    KXJ82704.1    AAGJ04080524    AAGJ04135687    HAEG01015421    SBS00103.1    GL769615    EFZ10365.1    JYDV01000040    KRZ38954.1    GDRN01111556    JAI56762.1    AAGJ04008210    GDRN01111557    JAI56761.1    GCES01130483    JAQ55839.1    AAGJ04165044    GDIQ01143107    JAL08619.1    GEFM01002456    JAP73340.1    LNIX01000018    OXA45362.1    GCES01125647    JAQ60675.1    GCES01134385    JAQ51937.1    JYDU01000016    KRX99145.1    LBMM01009964    KMQ87756.1   
Pfam
PF17921   Integrase_H2C2        + More
PF18701   DUF5641
PF05380   Peptidase_A17
PF03564   DUF1759
PF00665   rve
PF05585   DUF1758
PF01565   FAD_binding_4
PF09129   Chol_subst-bind
PF00628   PHD
PF00078   RVT_1
Interpro
IPR040676   DUF5641        + More
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR008042   Retrotrans_Pao       
IPR005312   DUF1759       
IPR008737   Peptidase_asp_put       
IPR001995   Peptidase_A2_cat       
IPR001878   Znf_CCHC       
IPR006094   Oxid_FAD_bind_N       
IPR016166   FAD-bd_PCMH       
IPR016164   FAD-linked_Oxase-like_C       
IPR016170   Cytok_DH_C_sf       
IPR015213   Cholesterol_OX_subst-bd       
IPR036318   FAD-bd_PCMH-like_sf       
IPR016169   FAD-bd_PCMH_sub2       
IPR016167   FAD-bd_PCMH_sub1       
IPR011011   Znf_FYVE_PHD       
IPR013083   Znf_RING/FYVE/PHD       
IPR001965   Znf_PHD       
IPR019787   Znf_PHD-finger       
IPR019786   Zinc_finger_PHD-type_CS       
IPR000477   RT_dom       
IPR002999   Tudor       
IPR001841   Znf_RING       
IPR000253   FHA_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR001969   Aspartic_peptidase_AS       
SUPFAM
SSF53098   SSF53098        + More
SSF56176   SSF56176       
SSF55103   SSF55103       
SSF57903   SSF57903       

Ontologies

Topology

Length:
1039
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0637799999999998
Exp number, first 60 AAs:
0.04873
Total prob of N-in:
0.00330
outside
1  -  1039
 
 

Population Genetic Test Statistics

Pi
127.138561
Theta
53.81389
Tajima's D
4.110796
CLR
0.243812
CSRT
0.9994000299985
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号