SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15449
Pre Gene Modal
BGIBMGA004768
Annotation
PREDICTED:_nephrin-like_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 2.498
 

Sequence

CDS
ATGAGCCAAGCTTCCAGGTGTAGATTGCTGACATGGGCTGGCGGTAACATTGTCATTGTGTCCACCAGACTGGTGCTCAGATCTCTGAGTTTTACGGGTCGTCTGAGGGCACGTGTTTTCAGGTCTGGCCTCCAAAAGGGCTTCTTCCACTTGGGTGCCACTAATGTCCCTATAGTGACTTTGAAACTCGGATCTACCCTTAATCCTTCCCATATCAAGGAAGGTGACGACGTCTACTTCGAGTGCATTGTAAAAGCAAACCCGAAGACGCATAAGCTCACTTGGTATAAAGGAACTAAAGAAATTCAACATAACGCGAGTTCTGGAATCATTCTCAGCGACCAAAGCCTGGTGCTGCAAAGCGTCAGCCGATCAACCGCCGGGGACTATAGCTGTTTAGCATATAACAGCGAAGGAAGTGCCACTAGCAACCCTGTGTCTTTATTGATAAGGTATGCTCCAGTGTGCAAAACAATAAACGAAGGAGAAGTGTACGGCGCTTTGAAACAAGAGACGGTGACCTTGAATTGTGCTGTTGACTCCAGCCCAGCTCCCACCAGCTTCAGCTGGATCTTCAATAGCTCTGGCGACCAAACGGAGCTGGCTGCGAACACGTACACATCAGCTGGCTTCACTTCGAATCTTCGTTACACTCCGATTTCTGAAATGGATTTTGGCACGATACTCTGCATGGCAACTAACACAGTGGGAAGGCAGAAGATCCCATGCCTCTACAAGCTGATTGCGGCAGGACAGCCGACGGCACTCCACAACTGTTCAGTGGCGAACCAGAGCTCGGCCAGTTTACAAGTGGAATGCGCGGAAGGCTTCGACGGAGGGCTCCCGCAGGTTTTCTTCATGGAGGTCTTGGAACTCCCGGCTATGACCGTAATATTTGAATTTTATTATTTTTCAAATCATATCCTATGTCTTTTATAA
Protein
MSQASRCRLLTWAGGNIVIVSTRLVLRSLSFTGRLRARVFRSGLQKGFFHLGATNVPIVTLKLGSTLNPSHIKEGDDVYFECIVKANPKTHKLTWYKGTKEIQHNASSGIILSDQSLVLQSVSRSTAGDYSCLAYNSEGSATSNPVSLLIRYAPVCKTINEGEVYGALKQETVTLNCAVDSSPAPTSFSWIFNSSGDQTELAANTYTSAGFTSNLRYTPISEMDFGTILCMATNTVGRQKIPCLYKLIAAGQPTALHNCSVANQSSASLQVECAEGFDGGLPQVFFMEVLELPAMTVIFEFYYFSNHILCLL

Summary

EMBL
NWSH01000804    PCG74103.1    NWSH01001734    PCG70297.1    BABH01028139    ODYU01008707    + More
SOQ52514.1    KQ459596    KPI95282.1    AGBW02008416    OWR53449.1    KQ460118    KPJ17689.1    AGBW02013965    OWR42507.1    KQ971354    EFA06826.2    ATLV01014043    ATLV01014044    KE524931    KFB38312.1    KPJ17690.1    KPI95281.1    LJIG01002527    KRT84413.1    BT071799    ACN43735.2    GECU01031289    JAS76417.1    GECZ01013250    JAS56519.1    CH477492    EAT40016.1    GEZM01002471    JAV97235.1    AE014297    AAF54952.3    AFH06404.1    CH954181    EDV49222.1    CM000160    EDW97249.1    KRK03606.1    CM000364    EDX13063.1    GEHC01000109    JAV47536.1    CH480815    EDW42308.1    JRES01001160    KNC24967.1    GEBQ01019020    JAT20957.1    NEVH01020344    PNF21424.1    CH902617    EDV41691.1    KPU79296.1    KPU79297.1    KPU79299.1    CM000070    KRT00496.1    CH964272    EDW84074.1    AXCN02001176    CH940652    KRF78738.1    CH479179    EDW24155.1    EAL28149.2    KRT00494.1    KRT00495.1    KRT00497.1    OUUW01000013    SPP87858.1    ADMH02000629    ETN65555.1    EDW59180.1    KRF78739.1    KRF78740.1    GAKP01006691    JAC52261.1    PNF21422.1    CP012526    ALC47181.1    APCN01000864    GBRD01006221    JAG59600.1    GBHO01002348    GDHC01008300    JAG41256.1    JAQ10329.1    DS231868    EDS40777.1    GAMC01011313    JAB95242.1    CH933806    EDW14590.1    KRG01093.1    KRG01094.1    GBXI01011571    JAD02721.1    CH916369    EDV92962.1    CVRI01000006    CRK88301.1    GDHF01028633    GDHF01000289    JAI23681.1    JAI52025.1    GDHF01029500    JAI22814.1    GEDC01028050    JAS09248.1    KK852551    KDR21492.1    DS235315    EEB14623.1    AAAB01008987    EAA01081.5    UFQT01000721    SSX26761.1    SSX26760.1    KQ768496    OAD53110.1    KQ414740    KOC62013.1    ADTU01022145    ADTU01022146    ADTU01022147    ADTU01022148    ADTU01022149    ADTU01022150    ADTU01022151    ADTU01022152    KQ761039    OAD58331.1    KQ434809    KZC06457.1    KK107111    EZA59032.1    QOIP01000011    RLU16384.1    KQ436043    KOX67494.1    QOIP01000001    RLU26636.1    KQ978252    KYM95902.1    JTDY01000215    KOB78250.1    KB631716    ERL85562.1    APGK01045684    APGK01045685    APGK01045686    APGK01045687    APGK01045688    KB741037    ENN74695.1    KQ978957    KYN27022.1    GEZM01002480    JAV97230.1    ATLV01015761    ATLV01015762    KE525036    KFB40641.1    GL435806    EFN72580.1    GL888115    EGI67140.1    GEDC01017936    JAS19362.1    LJIJ01000097    ODN02743.1    KPI95261.1    KZC06717.1    APCN01002092    APCN01002093    GL446373    EFN87898.1   
Pfam
PF08205   C2-set_2        + More
PF07686   V-set
PF07679   I-set
PF00047   ig
Interpro
IPR013783   Ig-like_fold        + More
IPR013162   CD80_C2-set       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR003961   FN3_dom       
IPR036116   FN3_sf       
IPR036179   Ig-like_dom_sf       
IPR003598   Ig_sub2       
IPR013106   Ig_V-set       
IPR013098   Ig_I-set       
IPR013151   Immunoglobulin       
SUPFAM
SSF49265   SSF49265        + More
SSF48726   SSF48726       
Gene 3D
PDB
3KLD     E-value=3.17813e-07,     Score=129

Ontologies

Topology

Length:
312
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
10.89453
Exp number, first 60 AAs:
8.7378
Total prob of N-in:
0.43455
outside
1  -  312
 
 

Population Genetic Test Statistics

Pi
42.339934
Theta
183.931552
Tajima's D
-2.567689
CLR
1290.809466
CSRT
0.000149992500374981
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号