SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15447
Pre Gene Modal
BGIBMGA010456
Annotation
PREDICTED:_uncharacterized_protein_LOC105842393_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.204
 

Sequence

CDS
ATGGATATTAAATCATTAAAGAAAACTAGATCTAGCCATAAGGCGAAGCTTACCATATTTAAAACATATATAGATTCACTTTTGCCTAGTAAAAGGGTCAATGAGGTACAAGCTTTTGAATTAAAGGCTCGCTTAGATAAAATTCTAGATTTATACAATGAGTTCGATTCAGTTCAGACTGATTTAGAAAGTCTTGTGGAAATTTCAGATGATGAACACAAGGAAAGAGAGATTTTCGAGAACAGCTACTTCGGCTGCGTGGCTTTTGCGCAGAAGATGCTCAGCGCTGCCTCTGCGGATCAGGATGCCGGGTCGGTGACGGGTTCTAATATTAACACTGGACCGTCTGAATTGCAGATCCGAAATAAATGGCGCACAAATAGAGGACAACCACAGCCAGGAGAGATGGTTCTCATTAAAGATGATCGGCTGCCCCCCAATAGATGGCTGCTGGGACGTGTCACCACAGTTTACCCAGGCGCTGACGGCGTCAACCGGGTGGCAGACGTAAAAACTACTTCAGGAACCTTACGCAGAGCTTGGAATAGGCTCTGTCCATTACCAGTTATTTTGGACCAGAAAGATGCATCTGCTCCAAGAGGGCCAGTTTGTTAA
Protein
MDIKSLKKTRSSHKAKLTIFKTYIDSLLPSKRVNEVQAFELKARLDKILDLYNEFDSVQTDLESLVEISDDEHKEREIFENSYFGCVAFAQKMLSAASADQDAGSVTGSNINTGPSELQIRNKWRTNRGQPQPGEMVLIKDDRLPPNRWLLGRVTTVYPGADGVNRVADVKTTSGTLRRAWNRLCPLPVILDQKDASAPRGPVC

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
204
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0029
Exp number, first 60 AAs:
0
Total prob of N-in:
0.31008
outside
1  -  204
 
 

Population Genetic Test Statistics

Pi
267.030891
Theta
183.570095
Tajima's D
1.127311
CLR
276.497311
CSRT
0.693015349232538
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号