SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15445
Pre Gene Modal
BGIBMGA004752
Annotation
PREDICTED:_hemicentin-1?_partial_[Plutella_xylostella]
Location in the cell
Nuclear   Reliability : 2.257
 

Sequence

CDS
ATGGCGTTATCAAAAAAAAACTGTCATCATCTGTGGCATTTAACTCACGTCACATCGCACGCAATGCCAACATCGGACGTGCAAGGCGTTCTGGGGAAGAAAGCTTCGTTACCCTGCGACATTCAGCCTCTGCATTCAGAAGACGAAGTCGTGATGGTGCTCTGGTTCAAGGAGTCTGATGGAGATCAACCTTTATATAGCTACGACATTCGTGGCCGGTCACAAAGTCAGCCCAAGCTGTGGTCTTCGCCGACCGTGTTCGCAAACCGGGCATTCTTCAGAGGAACCGCTACGCCTGCAGTCTTGATGCTGGACAATGTGATGGCCACTGATGCAGGAGTCTACAGGTGTAGAGTAGATTTCAAGAATTCGCCCACAAGAAATCTAAAAGTCAATTTTACTGTCATAATGCCTCCAAATCGTCCGACGATATTCGATGCCAAACGAAGAGACCGAACAAAATTAGTCGAACCATACAATGAAGGGGCCAACGTATTGCTAATCTGCGAAGTCGAAGGAGGAAATCCAAGACCTCGTGTAACGTGGTACCTGGAGAACACGGTGATAGACGACTCATTTGAGCAGCGTCCTGATGGAGTAACCGTCAACACCCTGACCTTCCCCAACGTGGGTCGTCAGCACCTCAACGCAAGACTCGTCTGCCAAGCTTCGAACACCAATCTGGCGCCACCGGAAACGAAAGTCCTGATATTAGACATTAATTTGAAGCCGATATCGGTGACGATCCTGACGAAGGAGAAGCAAATATCGGCCGACAAAAGGTACGAAGTGGAGTGCAAGACGACGGGCTCCCGGCCCGAGGCGTATGTCACTTGGTGGAAGAACAATAGACAGCTGAAGCGGATGGCAAAAAACTTCTCAGAGAACAATGAGACGCTAAGCGTTTTGAGTTTAGTGCCAGGGGTTGAAGATGACGGGAAATACCTAGCTTGCCGAGCCGAGAACAAACATATACCAGATTCAGCAATTGAAGACAAGTGGCGACTAAATGTTCACTATGTACCAATAGTGGATCTGAAAATGGGCTCCAACCTAAACCCTGACGAGATCAAGGAAGGGGACGACGTTTATTTCGAGTGCACTGTCAAGGCTAATCCGAAGACACATCGCCTTGTTTGGTTTCACGATAACTCTGAAATTTACCACAACGAAGCAGCAGGTGTGATTCTTAGTGCTCAGAGCTTGGTCCTTCAGAGCGTCACTAGAGCAGCTGCTGGGGACTACACCTGCATGGCTGCTAACAGTGAAGGAAAAGGAACTAGCAACCCGGTGACGCTGCTAGTGCGATATGCCCCTGTTTGCGCTGAACGAAGAGATGGAGAACTATTTGGAGCCCTCAAGCATGAAACAGTATCTCTGCATTGTTCTGTAGATGCGAACCCCGCACTGGTGTCTTTCCACTGGACCTTTAATAATTCTGGCGAACAAACGGAAATCCCACCAAGGTTATACAGTAGTCACGGCCACACATCCACCTTGAACTATACTCCGACAACGGACATGGAGTATGGAACTCTGGCCTGTTTCGGCGAGAACACTGTTGGACAACAAAAAGTACCGTGTCTATTCCAATTAGTAGCTGCAGGTCGTCCATTCCCACTTCAGAACTGCACAGTGGCTAACCAAAGCATTGATTCTCTGTATGTCGAGTGTGTTGAGAACTTCGATGGTGGACTGCCACAGACCTTCCTGATGGAGCTGCTTGAGCTGCCCTCATTAGCAGTCCGATACAACGTATCTACAAACAGGACACCACCCTACTTCGAAATCAAAGGTCTTCCGCCAGGCGTTAGCTACAGGATAGAGCTGTATGCTGTCAACGCAAAAGGCAGAAGCGATGTGTCTACCATTGAAACAGTCACTTTGAAGGGTCAAGCTAAATTTACTGGTGAAAGCAACGCCCTCGGAATGTCACCAGTCTTAGCTTCAATAGCTGCGTCATCAGCTCTACTGGCTGCAGCTGTCTGTGGGGTTCTGGCTGTACTCTATAAGAAGCATAGCAACAGACAACGACGGCTTCCCGCCAAACATGCCCCATTGAGTGAATCAATGTACGTCGAACGAACACCGAACTGTCCGACTCCAGTGAAGCAGGAGGTGGAGTCCCGCGCCAGCAGTACGGAGCCCCGAGACCAGAGGTCGGAGCGAGGGGCCAGAGGGGCTTTACTGCACACATCTGATCCCATGGCTGACGACGCTGATCCCGATATAATTCCTTGTTTATATGAGAGGAGACCAGTGTCCAACGGGTACATGAGCCTCCAGAGACCTCCGTCCAGTACAAAGATCGCCAAGATGAGCGGTGACGACATTCGTTCAGAGCCCGACGGCGGCGCCTACTACAACGATTATAGGAAAAAGGATTACAAAATACCTTTAACTAGCTCGTACCACAGTCTAGGGAGAGCCAACAAGGGCGTCACGGCGTGCAGCCCTGGTTCCGCGACGGGCGTGACGTCATCACTGACGCAACATCGACTGCGGCCGGAAGTCGTCACCACCTCGCATCGAGTGCAAGAGAGCTGTATATAA
Protein
MALSKKNCHHLWHLTHVTSHAMPTSDVQGVLGKKASLPCDIQPLHSEDEVVMVLWFKESDGDQPLYSYDIRGRSQSQPKLWSSPTVFANRAFFRGTATPAVLMLDNVMATDAGVYRCRVDFKNSPTRNLKVNFTVIMPPNRPTIFDAKRRDRTKLVEPYNEGANVLLICEVEGGNPRPRVTWYLENTVIDDSFEQRPDGVTVNTLTFPNVGRQHLNARLVCQASNTNLAPPETKVLILDINLKPISVTILTKEKQISADKRYEVECKTTGSRPEAYVTWWKNNRQLKRMAKNFSENNETLSVLSLVPGVEDDGKYLACRAENKHIPDSAIEDKWRLNVHYVPIVDLKMGSNLNPDEIKEGDDVYFECTVKANPKTHRLVWFHDNSEIYHNEAAGVILSAQSLVLQSVTRAAAGDYTCMAANSEGKGTSNPVTLLVRYAPVCAERRDGELFGALKHETVSLHCSVDANPALVSFHWTFNNSGEQTEIPPRLYSSHGHTSTLNYTPTTDMEYGTLACFGENTVGQQKVPCLFQLVAAGRPFPLQNCTVANQSIDSLYVECVENFDGGLPQTFLMELLELPSLAVRYNVSTNRTPPYFEIKGLPPGVSYRIELYAVNAKGRSDVSTIETVTLKGQAKFTGESNALGMSPVLASIAASSALLAAAVCGVLAVLYKKHSNRQRRLPAKHAPLSESMYVERTPNCPTPVKQEVESRASSTEPRDQRSERGARGALLHTSDPMADDADPDIIPCLYERRPVSNGYMSLQRPPSSTKIAKMSGDDIRSEPDGGAYYNDYRKKDYKIPLTSSYHSLGRANKGVTACSPGSATGVTSSLTQHRLRPEVVTTSHRVQESCI

Summary

EMBL
ODYU01008707    SOQ52514.1    KQ459596    KPI95281.1    AGBW02008416    OWR53449.1    + More
KQ460118    KPJ17690.1    GEZM01002471    JAV97235.1    NEVH01020344    PNF21422.1    KQ971354    EFA06826.2    ADMH02000629    ETN65555.1    AXCN02001176    KK852551    KDR21492.1    GBHO01002348    GDHC01008300    JAG41256.1    JAQ10329.1    JTDY01000215    KOB78250.1    GBRD01006221    JAG59600.1    APCN01000864    JRES01001160    KNC24967.1    CH940652    EDW59180.1    KRF78739.1    KRF78740.1    KRF78738.1    DS235315    EEB14623.1    AAAB01008987    GEDC01028050    JAS09248.1    GEHC01000109    JAV47536.1    GECZ01013250    JAS56519.1    GBXI01011571    JAD02721.1    GEBQ01019020    JAT20957.1    OUUW01000013    SPP87858.1    CH902617    EDV41691.1    KPU79296.1    KPU79297.1    KPU79299.1    CP012526    ALC47181.1    GDHF01028633    GDHF01000289    JAI23681.1    JAI52025.1    CM000070    EAL28149.2    KRT00494.1    KRT00495.1    KRT00497.1    GDHF01029500    JAI22814.1    CH477492    EAT40016.1    KRT00496.1    CH479179    EDW24155.1    GAKP01006691    JAC52261.1    GAMC01011313    JAB95242.1    CH916369    EDV92962.1    UFQT01000721    SSX26760.1    CH933806    EDW14590.1    KRG01093.1    KRG01094.1    AE014297    AAF54952.3    AFH06404.1    CM000364    EDX13063.1    CH954181    EDV49222.1    CM000160    EDW97249.1    KRK03606.1    CH964272    EDW84074.1    CH480815    EDW42308.1    BT071799    ACN43735.2    EAA01081.5    DS231868    EDS40777.1    KPI95282.1    CCAG010005698    CCAG010005699    KPJ17689.1    QOIP01000001    RLU26636.1    ADTU01022145    ADTU01022146    ADTU01022147    ADTU01022148    ADTU01022149    ADTU01022150    ADTU01022151    ADTU01022152    KQ414740    KOC62013.1    KQ436043    KOX67494.1    KQ434809    KZC06457.1    GL435917    EFN72486.1    NWSH01000804    PCG74103.1    KQ977791    KYM99751.1    GBYB01015336    JAG85103.1    KYM99745.1    ADTU01012031    ADTU01012032    ADTU01012033    ADTU01012034    ADTU01012035    ADTU01012036    QOIP01000011    RLU16384.1    KQ981727    KYN36898.1    KQ435719    KOX78734.1    NNAY01000092    OXU31062.1    KK107111    EZA59032.1    KQ978252    KYM95902.1    LBMM01000823    KMQ97414.1    RLU26631.1    KK107087    EZA59930.1    GL888115    EGI67145.1    GL453802    EFN75491.1    KQ980419    KYN16096.1   
Pfam
PF07686   V-set        + More
PF08205   C2-set_2
PF07679   I-set
PF00047   ig
PF00041   fn3
Interpro
IPR003598   Ig_sub2        + More
IPR036179   Ig-like_dom_sf       
IPR013106   Ig_V-set       
IPR036116   FN3_sf       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR003961   FN3_dom       
IPR013783   Ig-like_fold       
IPR013162   CD80_C2-set       
IPR013098   Ig_I-set       
IPR013151   Immunoglobulin       
IPR009072   Histone-fold       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
SSF47113   SSF47113       
Gene 3D
PDB
5ZO2     E-value=7.09809e-13,     Score=182

Ontologies

Topology

Length:
850
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.38888
Exp number, first 60 AAs:
0.00081
Total prob of N-in:
0.00186
outside
1  -  646
TMhelix
647  -  669
inside
670  -  850
 
 

Population Genetic Test Statistics

Pi
203.593423
Theta
168.778642
Tajima's D
0.738203
CLR
0.136279
CSRT
0.581770911454427
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号