SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15442
Annotation
PREDICTED:_uncharacterized_protein_LOC106713162_[Papilio_machaon]
Location in the cell
Mitochondrial   Reliability : 3.228
 

Sequence

CDS
ATGAATATTCTTGCCACAAAACACGAACAAAAAGACTTCCGAGGTTTCTGGAAACAAACAAGGAGATTGAGTCCAAAAGCTGGTATCCCGGTGAGCATTGATGGCGAGTGTGAGCCTGTGAGGATTGCTAATCTGTTTAGGAACCATTTCAGGGTACAATCACCCGGTCAGTTAAGTAGAGGTGCTGATGCTGGGGTGGTGGACCCGAGTCGACCCTCGCAAGTACCACCTCGGATAACAACGAAGGAAATAACTAAAATTATAATGAATATGACTAAGGGTAAGTCTCCCGGTCATGACCACCTCAGCATTGAGCACTTTCAACACGCCGGTCCGCATTTACCTAGATTGCTAGCGCTCTTATATACCTTCTGTATCAGACATTCGTATCTGCCCGGGGCGTTAATGAGAACGGTCGTTGTCCCGATTTTAAAAAATAAAACAGGCGACGTATCGGATCGTAACAACTATCGGCCGATCTCCCTGGCAACCATAACTGCTAAGGTACTCGATGCAGTGCTCGAGCGACAGGTGAGTGATCATCTTAAATTAAGTGATGCTCAGTTCGGTTTTAGACCGATGTTATCTACCGAGTGTGCAATCCTGTCGCTAAAGCATGTGGTGGGATACTACACGGAGAAGAATACGCCTGTTTATGCAGTGTTTCTCGATCTTTCGAAGGCTTTCGACCTAGTCAGGTACGACTTGTTGTGGGGTAAGTTGAGGCAGACGGGCGTACCGGGACCTTACGTGGACTTGTTCTCCCATTGGTACGAGTATCAGACCAATCAGGTAAGATGGTCAAACACACTTTCGGAGGAGTACAGGTTGGAATGCGGGGTGAGGCAGGGGGGCTTAACCTCACCGGCGCTTTTCAACCTGTATATTAATGAGTTGATCGAGGCACTCGGTGAGGCACGTGTCGGCTGCTCGATTGATGGTCACTGTGTGAACAGCATCAGTTACGCTGACGACATGGTGCTGTTGAGCCCATCGATCGGTGCTCTCCGGCGGTTGTTGTCCATCTGTGAGAGGTACGCGGAATCTCACGGGCTCCGCTATAATGTTAAAAAAAGTGAACTGCTCGTCTTTAAGGCAGCAAAGACAAAACCGAGTTATGTGCCACCAGTGACGCTCGGAGGTACTCCACTGAAGAGGGTTACTGAGTTCAAATACCTTGGCCATATTGTAACTGAGCACCTTAAAGATGATGCAGATATTGAAAGGGAACGGAGAGCGTTGGCTGTCCGCTGCAGTATGCTGGCCCGCAGGTTCTACCGTTGTACCGCACAGGTTAAGGATGTTGTTGGGGCTCCCGCGGTACTGTAG
Protein
MNILATKHEQKDFRGFWKQTRRLSPKAGIPVSIDGECEPVRIANLFRNHFRVQSPGQLSRGADAGVVDPSRPSQVPPRITTKEITKIIMNMTKGKSPGHDHLSIEHFQHAGPHLPRLLALLYTFCIRHSYLPGALMRTVVVPILKNKTGDVSDRNNYRPISLATITAKVLDAVLERQVSDHLKLSDAQFGFRPMLSTECAILSLKHVVGYYTEKNTPVYAVFLDLSKAFDLVRYDLLWGKLRQTGVPGPYVDLFSHWYEYQTNQVRWSNTLSEEYRLECGVRQGGLTSPALFNLYINELIEALGEARVGCSIDGHCVNSISYADDMVLLSPSIGALRRLLSICERYAESHGLRYNVKKSELLVFKAAKTKPSYVPPVTLGGTPLKRVTEFKYLGHIVTEHLKDDADIERERRALAVRCSMLARRFYRCTAQVKDVVGAPAVL

Summary

Similarity
Belongs to the peptidase S1 family.
EMBL
GAIX01014011    JAA78549.1    NWSH01000012    PCG80896.1    KZ150039    PZC74591.1    + More
RSAL01000132    RVE46368.1    KZ149940    PZC76937.1    KZ150185    PZC72467.1    RSAL01004459    RVE40147.1    NHMN01024349    PZC87407.1    KZ150122    PZC73158.1    KZ150625    PZC70440.1    KZ149956    PZC76465.1    RSAL01000010    RVE53771.1    HAEJ01003895    SBS44352.1    GCES01018090    JAR68233.1    GCES01119762    JAQ66560.1    GCES01122004    JAQ64318.1    GCES01120657    JAQ65665.1    GDRN01099830    JAI58698.1    DMQF01000358    HAO15222.1    DMQF01000507    HAO15811.1    DMQF01000051    HAO14134.1    DNUT01000366    HBI40674.1    REGN01000623    RNA40614.1    UFQT01000284    SSX22780.1    AAGJ04127121    AAGJ04127122    AAGJ04127123    CM003613    KYP56875.1    JARK01001412    EYC06431.1    GEZM01094272    GEZM01094271    JAV55745.1    JARK01001379    EYC13704.1    KQ484600    KYP34423.1    JARK01001398    EYC09120.1    RQTK01000700    RUS75926.1    NCKU01002988    RWS08398.1    JARK01001345    EYC27241.1    GFTR01008526    JAW07900.1    AAGJ04171899    GEGO01006907    JAR88497.1    GGMS01004979    MBY74182.1    NSIT01000254    PJE78133.1    AAGJ04093867    FJ265563    ADI61831.1    DMQF01000521    HAO15860.1    JARK01001422    EYC04705.1    GBHO01042545    GBRD01013465    JAG01059.1    JAG52361.1    GDHC01021277    JAP97351.1    GBHO01021345    JAG22259.1    JARK01000194    EYC40844.1    JARK01001423    EYC04580.1    EYC40845.1    PDHN01000949    PGH37547.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF12832   MFS_1_like
PF00089   Trypsin
PF00057   Ldl_recept_a
PF03372   Exo_endo_phos
PF01392   Fz
Interpro
IPR000477   RT_dom        + More
IPR024989   MFS_assoc_dom       
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036259   MFS_trans_sf       
IPR020846   MFS_dom       
IPR033116   TRYPSIN_SER       
IPR036790   Frizzled_dom_sf       
IPR020067   Frizzled_dom       
IPR009003   Peptidase_S1_PA       
IPR001314   Peptidase_S1A       
IPR001190   SRCR       
IPR001254   Trypsin_dom       
IPR018114   TRYPSIN_HIS       
IPR036055   LDL_receptor-like_sf       
IPR002172   LDrepeatLR_classA_rpt       
IPR027124   Swc5/CFDP2       
IPR000637   HMGI/Y_DNA-bd_CS       
SUPFAM
SSF103473   SSF103473        + More
SSF56219   SSF56219       
SSF50494   SSF50494       
SSF57424   SSF57424       
SSF63501   SSF63501       
Gene 3D
PDB
5HHL     E-value=2.83803e-08,     Score=140

Ontologies

Topology

Length:
442
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0799599999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.01238
outside
1  -  442
 
 

Population Genetic Test Statistics

Pi
249.472741
Theta
130.579816
Tajima's D
2.960263
CLR
0.384229
CSRT
0.977501124943753
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号