SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15400
Annotation
PREDICTED:_uncharacterized_protein_LOC105391048_[Plutella_xylostella]
Full name
Galactose-1-phosphate uridylyltransferase      
Location in the cell
Nuclear   Reliability : 2.851
 

Sequence

CDS
ATGGAGCCACAACAAAGAAAGCAGCCAGCAGCGACGCCGGACGAATTTTTGGACACGGAGGGTACCTCATATGCTGCCTCGCTAGAAACGTCGAGAATCGGTTTCCGTCCACCCCCGTTTTGGCCAGAGGAACCAGAGCTATGGTTCGCGCAGGTGGAAGGCCAATTCGTGTTGGCGAATATCAAAACGGACTCCACAAAGTTTTATTCCGTCATCGCCGTTTTGGAGCACAGACACATATCGGAGGTAAAAGATATTATAACCAACCCTCCGACCGAAGAAAAATATAACAAACTGAAAACGGAATTAATTAAACGGTTATCTGCATCTCAAGAACGGAAGGTAAAACAATTATTAATGCATGAAGAGTTAGGGGACCGCAAACCGTCTCAGTTTTTGAGACATTTGAGTAACCTGGCAGGACCTTCAGTGCCGGACGATTTCGTGAAAACGTTGTGGTCGAGTCGATTGCCGAGTAATATACAGACTATTGTAGCTTCCCAGTCAGATCTTCCACTCGATAAGTTAGCTGACCTGGCGGATAAAATACACGAACTTGCACCCTCTGCACCATACCAGGTAGCGAGTACAGCTCACTCCGCGCCTACTTCAACTCAAGGGTCGGACCTGTGTGTGTATCCTAGATCAGCTATGAAAACACCCTGTACGCAAGCCAAGTATACCTTAACTGCCGCAAATGGTTCAGTAATACATACCTATGGACAGATACATATAACATTAGATTTGGGACTGCGCCGTGCTTTCTCTTGGAAATTTACCATTGCAGACATTGCAAAGCCAATTATTGGTATTGATTTTTTAAATTTTTACAACCTGCTAATTGACTGCCGTAATCACAGAATTATAGATGGGACTACTTCACTAGCTGTGCCAGCATCACATCAGAAAGTTCCGGATAGCGTGGCATCGGTCAAGACAATTTCCGGTGATTCAGTATTTCACCAGCTTCTACGTGAGTTCCCAGAAGTTACACGACCTGCGGGTACTGTAAGTACACCTAAGCATAACACTATGCACTTTATTAAAACTACGTCTGGACCACCAGTTACGAGTAGACCTAGACGGTTGGATCCCGAACGCTTGCGACACGCCAAAAAAGAATTTGACGACATGCTAGCATGTGGCACGGCAAGGCGTTCGTCAAGCCCATGGTCCTCACCGTTGCACTTGGTCAAAAAGAAGGATGATGGCTGGAGACCCTGTGGTGATTACCGTGCACTAAATGCTCGTACCGTGCCCGATCAATACCCTGTACGCCACATTCAGGACTTTAGTCAGCAGCTTTCTGGATGTACTATCTTTTCAAAAATTGATCTTATTAAAGCTTATAATCAGATTCCCGTAAATCCCTCTGACATACCCAAGACAGCGATCACCACACCATTTGGCATGTTTGAGTTCCCGTACATGACATTTGGTCTAAGAAACGCAGCTCAAACTTTTCAGCGGTTTATTGATGAAGTGCTCACAGGCTTAAATGACTTCTGCTATGGGTTCATGGACGATTTGTTAATTTTTTCCGAGTCACGTGATCTTCACATGACCCATGTGCGACAGGTACTTGCCAGACTTAAGGAATATGGCGTTCTAATCAACCCAGCCAAATGTTCTTGGGGTAGAAATGAAGTTAGTTTCCTCGGATATCATGTTTCTGCTGAAGGTACACGTCCTCTTCAAGAGAAAGTCCAGGTTATCCAGGAATTTCCTGTACCACGAACAGTAAAGGAGCTCCGAAGGTTTCTCGGTATGTTGAATTTCTATAGAAGGTTCATTCCTGATGCAGCGACTATTGAAGCACCTCTACACAGTATGTTGGCAGGAGAGAAGGTAAAAGGGTCACAGCCTGTCCACATGACCCCACTACAGCTGGAAGCCTTCGAAGAATGCAAAAGAGCATTATCTCAGGCTACACTTCTGGTACATCCCAATATGCAAGCTGAGTTGTCTATAGTTACTGACGCATCTGACGTGTCTATTGGAGCGACTTTGCAACAGCGTATACGAGACCAATGGGAACCACTCGGGTTCTTCTCCAAAAAATTAAGTCCGAGTCATAGGAAGTATAGTCCATATGACAGGGAGTTACTAGCAATATACGAAGCAATTAAATATTTTAGGCATATGGTAGAAGCTAGAAACTTTAGTATATACACTGACCACCGACCACTTGTTTACGCTTTCTCTAGGTCAAAAGATAATTGTTCTCCAAGACAGTACAGGTATTTTGATTTTATCGCACAGTTCACCACTGATATAAGGTACATACCTGGTACGCAGAATATTGTGGCAGACACGTTGTCACGTATAGAGGAGGTACAAGCCATCGACTTCCATCAGTTAGCCCTCTCACAAGAATCAGATCCCGAACTACAAAACCTACTCAACAAGGGATCGTCACTAAAGCTACGGAAGATAGCTCCAGCTGGATCATACACGGAACTGTACTGTGACATGTCAGTGCAACCGCCAAGACCCTACGTCACACCTGATTTTCGGAAGCAGGTTTTCGACTCACTGCACGGTCTTAGCCATCCAGGTGGTGCTGCTACAGTCCGACTTGTGACCGAACGATTTGTATGGCCTGGAATACGTCGTGACTGCAGAGATTGGTCGAGGAATTGCTTGCACTGCCAGCGATGCAAAGTTACCCGTCACACAACAGCCCCACTTTCCAGTTTTCCTTTGACCACGTCGAGATTCTCCTGTATCCATCTCGACATTGTAGGACCACTAACCCCTTCTGCTAATTACAGATATTGTCTTACCGTCATCGACCGCTTTACGCGATGGCCTGAGGCAATACCGATGATGGAGATCACTGCTGAAGCTTGCGCAACTGCTCTCGTATCAGGATGGATATCCAGGTTCGGCTGTCCCACTCAAGTTACCACCGACCAGGGTCGACAGTTCGAATCAGCTCTCTTCAAGTCCATCACGTCCATGGTGGGAGCCAGGCATTTCCGTACGACATCTTACCATCCAAGCTCTAACGGGATGATTGAGAGACTCCATCGCCAGCTGAAGGCAGCAATAATGTGCCACAGTACTAGCCAATGGACCGAATCTTTACCACTGGTGCTGCTCGGTATCCGTACTTCTTGGAAGGAAGACATTCAATCTTCTGCTGCCGAGCTGGTGTATGGGGAACCTTTACGCTTACCAGGGCAATTTCTCTTTCCATACGAAGATCACACTACCAGTGATGTTACTTCCTTCGCGGTACGCCTAGCTAAACAGATGTCTAGCCTTACACCAACACCAGCGGCATGGCATAGAAAAGGACCATTTTACGTACCAAGAGATCTGCAAACTTGTACCCATGTCTTCGTGAGACAGGACCATGTTCGCAGACCCCTTGAAGCGCCCTATTCTGGTCCACACAAAGTGTTGAAACGTCACGAAAAATTTTTTAAGGTTGAAGTCTACGGTAGAAAGGTCAATGTTTCATTAGATCGGCTGAAGCCAGCTTTTATAACTCGAGAAGCTATAAATGTTGCAGATACACCTTCTACTCCATCCCCGGCAGCCACTTTGTTACCTGCACCAGAGTCCGAGAAGAAGACAAGAAGTGGAAGGCGAGTGCGATTCCCGGACTACTACCAGGGTTAG
Protein
MEPQQRKQPAATPDEFLDTEGTSYAASLETSRIGFRPPPFWPEEPELWFAQVEGQFVLANIKTDSTKFYSVIAVLEHRHISEVKDIITNPPTEEKYNKLKTELIKRLSASQERKVKQLLMHEELGDRKPSQFLRHLSNLAGPSVPDDFVKTLWSSRLPSNIQTIVASQSDLPLDKLADLADKIHELAPSAPYQVASTAHSAPTSTQGSDLCVYPRSAMKTPCTQAKYTLTAANGSVIHTYGQIHITLDLGLRRAFSWKFTIADIAKPIIGIDFLNFYNLLIDCRNHRIIDGTTSLAVPASHQKVPDSVASVKTISGDSVFHQLLREFPEVTRPAGTVSTPKHNTMHFIKTTSGPPVTSRPRRLDPERLRHAKKEFDDMLACGTARRSSSPWSSPLHLVKKKDDGWRPCGDYRALNARTVPDQYPVRHIQDFSQQLSGCTIFSKIDLIKAYNQIPVNPSDIPKTAITTPFGMFEFPYMTFGLRNAAQTFQRFIDEVLTGLNDFCYGFMDDLLIFSESRDLHMTHVRQVLARLKEYGVLINPAKCSWGRNEVSFLGYHVSAEGTRPLQEKVQVIQEFPVPRTVKELRRFLGMLNFYRRFIPDAATIEAPLHSMLAGEKVKGSQPVHMTPLQLEAFEECKRALSQATLLVHPNMQAELSIVTDASDVSIGATLQQRIRDQWEPLGFFSKKLSPSHRKYSPYDRELLAIYEAIKYFRHMVEARNFSIYTDHRPLVYAFSRSKDNCSPRQYRYFDFIAQFTTDIRYIPGTQNIVADTLSRIEEVQAIDFHQLALSQESDPELQNLLNKGSSLKLRKIAPAGSYTELYCDMSVQPPRPYVTPDFRKQVFDSLHGLSHPGGAATVRLVTERFVWPGIRRDCRDWSRNCLHCQRCKVTRHTTAPLSSFPLTTSRFSCIHLDIVGPLTPSANYRYCLTVIDRFTRWPEAIPMMEITAEACATALVSGWISRFGCPTQVTTDQGRQFESALFKSITSMVGARHFRTTSYHPSSNGMIERLHRQLKAAIMCHSTSQWTESLPLVLLGIRTSWKEDIQSSAAELVYGEPLRLPGQFLFPYEDHTTSDVTSFAVRLAKQMSSLTPTPAAWHRKGPFYVPRDLQTCTHVFVRQDHVRRPLEAPYSGPHKVLKRHEKFFKVEVYGRKVNVSLDRLKPAFITREAINVADTPSTPSPAATLLPAPESEKKTRSGRRVRFPDYYQG

Summary

Catalytic Activity
alpha-D-galactose 1-phosphate + UDP-alpha-D-glucose = alpha-D-glucose 1-phosphate + UDP-alpha-D-galactose
Similarity
Belongs to the galactose-1-phosphate uridylyltransferase type 1 family.
EC Number
2.7.7.12
EMBL
LBMM01013040    KMQ85849.1    LBMM01012479    KMQ86204.1    LBMM01009142    KMQ88359.1    + More
LBMM01013103    KMQ85815.1    GBXI01015889    JAC98402.1    LBMM01012567    KMQ86146.1    AAGJ04164195    AAGJ04164196    AAGJ04164197    AAGJ04112098    GFDL01003994    JAV31051.1    AAGJ04001742    LBMM01012160    KMQ86374.1    GBXI01003773    JAD10519.1    AAGJ04130731    GBXI01017046    JAC97245.1    LBMM01012134    KMQ86388.1    KQ971355    EFA07205.2    LN877232    CTR11708.1    EF426679    ABP48077.1    GEGO01003687    JAR91717.1    GEGO01001281    JAR94123.1    KQ973093    EFA13472.2    GGFK01003401    MBW36722.1    LBMM01012633    KMQ86092.1    GGFK01003442    MBW36763.1    KL363241    KFD51254.1    MRZV01001828    PIK35719.1    GEGO01004649    JAR90755.1    GEGO01004484    JAR90920.1    ABLF02030693    ABLF02030697    LBMM01001181    KMQ96765.1    KL367655    KFD60653.1    BK004070    DAA04500.1    CABG01000050    CAZ37786.2    GGLE01001814    MBY05940.1    GEGO01000286    JAR95118.1    KL367492    KFD69854.1    AAGJ04172791    GDHF01014424    JAI37890.1    GDHF01001116    JAI51198.1    GEGO01003506    JAR91898.1    GDKW01003376    JAI53219.1    GDHF01021808    JAI30506.1    GACK01008900    JAA56134.1    GGLE01003443    MBY07569.1    KL367552    KFD64647.1    BK004066    DAA04495.1    GFPF01012375    MAA23521.1    RQTK01000577    RUS77485.1    DF142933    GAA49140.1    AY013563    AAK07485.1    AY013569    AAK07487.1    ABLF02058233    AAGJ04000250    AY013565    AAK07486.1    BN000802    CAJ00250.1    GEDV01001796    JAP86761.1    GBYB01009311    JAG79078.1    GEGO01004475    JAR90929.1    GEGO01004686    JAR90718.1    KL367544    KFD65142.1    KL367778    KFD59660.1    KL367543    KFD65158.1    FN356213    CAX83702.1    ABLF02040931    ABLF02040938    KL367664    KFD60497.1    NIVC01003188    PAA52757.1    JYDT01000067    KRY86703.1    JYDR01000002    KRY79251.1    AAZX01023279    JWZT01003175    KII67485.1    JWZT01005177    JWZT01001778    KII61927.1    KII71382.1    JWZT01004124    KII64665.1    JWZT01002058    KII70465.1    AAZX01006801    AAZX01023483    AAZX01009606    JYDO01000387    KRZ65366.1    QPMK01000035    RDD64024.1    FN356212    CAX83701.1    IAAA01040175    LAA10459.1    ABLF02011086    ABLF02042879    AAZX01013940    JWZT01001363    KII72172.1    ABLF02005645    ABLF02042063    KL367479    KFD72009.1    JYDJ01000353    KRX36608.1    JYDI01000020    KRY58560.1    KL363373    KFD46409.1    KRY58561.1   
Pfam
PF00665   rve        + More
PF00078   RVT_1
PF17919   RT_RNaseH_2
PF17921   Integrase_H2C2
PF17917   RT_RNaseH
PF01087   GalP_UDP_transf
PF00176   SNF2_N
PF00271   Helicase_C
PF05918   API5
PF02709   Glyco_transf_7C
PF13733   Glyco_transf_7N
PF00013   KH_1
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR000477   RT_dom       
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR001995   Peptidase_A2_cat       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR001969   Aspartic_peptidase_AS       
IPR034132   RP_Saci-like       
IPR013032   EGF-like_CS       
IPR041373   RT_RNaseH       
IPR005849   GalP_Utransf_N       
IPR019779   GalP_UDPtransf1_His-AS       
IPR001937   GalP_UDPtransf1       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036265   HIT-like_sf       
IPR016024   ARM-type_fold       
IPR014001   Helicase_ATP-bd       
IPR001650   Helicase_C       
IPR008383   API5       
IPR038718   SNF2-like_sf       
IPR027417   P-loop_NTPase       
IPR000330   SNF2_N       
IPR027791   Galactosyl_T_C       
IPR036612   KH_dom_type_1_sf       
IPR003859   Galactosyl_T       
IPR004087   KH_dom       
IPR004088   KH_dom_type_1       
IPR027995   Galactosyl_T_N       
IPR029044   Nucleotide-diphossugar_trans       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF54197   SSF54197       
SSF56219   SSF56219       
SSF52540   SSF52540       
SSF48371   SSF48371       
SSF54791   SSF54791       
SSF53448   SSF53448       
PDB
4OL8     E-value=8.65553e-70,     Score=675

Ontologies

Topology

Length:
1209
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0445900000000002
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00190
outside
1  -  1209
 
 

Population Genetic Test Statistics

Pi
138.849785
Theta
33.745255
Tajima's D
1.361799
CLR
0.13578
CSRT
0.755612219389031
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号