SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15398
Annotation
Retrovirus-related_Pol_polyprotein_from_transposon_412-like_Protein_[Tribolium_castaneum]
Location in the cell
Nuclear   Reliability : 3.404
 

Sequence

CDS
ATGAAACTAAATAGTTCATCCCATGACTCAATAAATCACAAATTCCACGTCATAGACAAGATTCATCTGCCTTATGACGGCATCATCGGATCAGATATGCTGAATCATTTCGGCTGCATGATTGACTATACTAAAAATCAACTTAAATTAAATAAAACATATTTACCACTCCGTTTTAATGAACCAACTTATACTATACCTGCTAGATCAGAAATGATAATCGAATGTTCCGTTTCAAACCCTGAAGTTAAACAAGGTCTTGTATTAGATCAAACTCAATTAAAGGATATCCTAATCGCAAATTGCCTAGTTAAAGTAAAAGAAAACAAACGAATAAACTTAACTGTAGTAAATATCTCTGAGTCTCCTAAAACTCTAACTTCAAACCTCAACATAACTTTGATTCCACTAGAACCTTCTGTCTTACATTCAAAAGAAACTTCAGAACAATACTCAATAAATACCGTTCAAACCCAAAATACCTTCCAACGAACTAAAGAAGTCCTAAATCAACTTCGAGTATCACACCTAAATTTTGAAGAATCTAATTCTCTTTACCAAATATGCTCTGACTATTCAGACATATTCCACTTACCTGGTGAACCATTGACATCAACTAACGTACTACGTCATAACATAAAAACCACAACCAATGATCCTATCCATGTAAAATCATACAGATTTCCCGAATGTCACAAACATGAAGTTCAAACTCAAATAGAGAAAATGCTTAAAGATGACATTATACAACCATCAATGTCTCCATGGTCTGCTCCTATTTGGGTAGTCCCGAAGAAACTTGATGCCTCCGGCCAGCGTAAATGGAGAGTTGTTATCGATTACAGGAAACTAAACGACATCACTATAGGTGACTCTTATCCTATCCCCAACATAAATGAAATTCTAGATCAACTCGGAAAATCAAAATATTTCTCCACGTTGGATCTTGCCTCTGGATTTCATCAGATCCAAATGTCTGCCGAAGATGCTCCTAAAACCGCTTTCAGTATTCCACAAGGACATTTTGAATTTAAAAGAATGCCATTCGGACTCAAGAACGCACCATCAACGTTCCAGAGATTAATGAACTCTGTCCTCTCAGGTCTGCAAGGCACTCGCTGCTTTGTGTATCTTGATGACATTGTAATATACTCGTATGACCTTGACTCTCATATGAATAACCTCGAAAGTGTATTTAAACGTCTACGAGAATTCAATCTTAAGCTTCAACCCGATAAGTGCGAATTCCTTCGAAAGGAAGTCTCGTACCTTGGCCACCTGATCACTGATGAAGGAGTCAAACCTGACCCAGCTAAGATCCGAGCCGTATCTGAATTTCCAGTTCCTAAATGCCCGAAAGATGTAAAATCTTTCCTAGGGCTTATGTCTTACTACCGAAAGTTTATTCCAGAATTTTCAAAAACAGCTAAATCATTAACTTCCCTATTAAAGAAAGATATCACCTTCACTTGGAACAACGAACAACAACTCGCTTTTGAAACACTCAAAAATCGTCTAATTTCTCCTCCTCTCCTCATATATCCCGATTTTACTAAACCATTTACCCTCACCTGTGATGCCTCTAACTACGCAATTAGTGCTATCCTCTCGCAAGGAGATCCAAATAGAGATAAGCCAATCGCTTACGCATCCCGGACCCTAAACAAAAGTGAAATAAATTACAATGTTACAGAAAAAGAATTATTAGCAATTATGTATGGGTGCAAAACTTTTAGACCTTACCTATATGGTCAAAAATTCAAAATCATAACCGATCATAATCCACTTAAGTGGCTTTTTAACCACAAAGACCCCTCAAGCAAGATGCAAAGATGGAGATTGAAATTAGAAGAGTATGACTACGAAATAACCCATAAAAAAGGCAAATTAAATTCAGCTGCAGACGCACTATCCAGATACCCCGTCAACCCTGTCAGAAGCTTAAATAATATAAACTCTGACCCAATTCCCGTCTTACCTATTTCTGACCCTCTGATCTCTTCTCAACCTGTACCCGAACAAAATCCACATCACTCTAACACATCTAATAGTGAACCTCCTCTTGAAACACTTCCTCTAGACGGCTTACTTACGTCAAGTCCTTTTAACCCTGATGATTACAACTTACCTTCACTAGAACCCCTTCAAGATATCGATCTCCTACCAAACAGTCCGTTCAATCCTGAAAATGAAATAGATGACCGCAATCTTAATAACAATGATAACATAAATCCTCCGACTAACAGTACTCCCAACCCTATGATTGATGATGAAAACCTACCAAGAAATCCATCAATTAACCTTCCGAGTCCCGAACCAAATTCCTGTCGGCACCATGTCAAGGCCTATCACGCACTCGAGAAATTACCAATATCGAACAAATTACGAAAAGCCCTGGCATCTACTTTAATCCCTCGGGATCTGTTAGGTTAA
Protein
MKLNSSSHDSINHKFHVIDKIHLPYDGIIGSDMLNHFGCMIDYTKNQLKLNKTYLPLRFNEPTYTIPARSEMIIECSVSNPEVKQGLVLDQTQLKDILIANCLVKVKENKRINLTVVNISESPKTLTSNLNITLIPLEPSVLHSKETSEQYSINTVQTQNTFQRTKEVLNQLRVSHLNFEESNSLYQICSDYSDIFHLPGEPLTSTNVLRHNIKTTTNDPIHVKSYRFPECHKHEVQTQIEKMLKDDIIQPSMSPWSAPIWVVPKKLDASGQRKWRVVIDYRKLNDITIGDSYPIPNINEILDQLGKSKYFSTLDLASGFHQIQMSAEDAPKTAFSIPQGHFEFKRMPFGLKNAPSTFQRLMNSVLSGLQGTRCFVYLDDIVIYSYDLDSHMNNLESVFKRLREFNLKLQPDKCEFLRKEVSYLGHLITDEGVKPDPAKIRAVSEFPVPKCPKDVKSFLGLMSYYRKFIPEFSKTAKSLTSLLKKDITFTWNNEQQLAFETLKNRLISPPLLIYPDFTKPFTLTCDASNYAISAILSQGDPNRDKPIAYASRTLNKSEINYNVTEKELLAIMYGCKTFRPYLYGQKFKIITDHNPLKWLFNHKDPSSKMQRWRLKLEEYDYEITHKKGKLNSAADALSRYPVNPVRSLNNINSDPIPVLPISDPLISSQPVPEQNPHHSNTSNSEPPLETLPLDGLLTSSPFNPDDYNLPSLEPLQDIDLLPNSPFNPENEIDDRNLNNNDNINPPTNSTPNPMIDDENLPRNPSINLPSPEPNSCRHHVKAYHALEKLPISNKLRKALASTLIPRDLLG

Summary

EMBL
GG694348    EFA13518.1    GEZM01081533    JAV61609.1    NEVH01026087    PNF14896.1    + More
LBMM01008064    KMQ89174.1    NEVH01019964    PNF22169.1    GGMR01006290    MBY18909.1    NEVH01025646    PNF15218.1    GFXV01006571    MBW18376.1    NEVH01009425    PNF32982.1    GDAI01000740    JAI16863.1    GGMR01005468    MBY18087.1    M32662    AAA92249.1    GGMR01003444    MBY16063.1    ABLF02041284    ABLF02041728    ABLF02024213    ABLF02042472    AY928610    AAX28844.1    NEVH01022642    PNF18384.1    ABLF02001345    ABLF02006651    ABLF02006655    ABLF02054079    ABLF02054906    ABLF02062695    GGMR01005970    MBY18589.1    AJ000387    CAA04050.1    GEHC01000906    JAV46739.1    GEDC01017847    GEDC01011974    JAS19451.1    JAS25324.1    ABLF02008732    ABLF02041376    NEVH01026392    PNF14303.1    NEVH01021952    PNF19057.1    GDHC01015253    JAQ03376.1    GEDC01002915    JAS34383.1    ABLF02041371    GEHC01000905    JAV46740.1    GBHO01007885    JAG35719.1    KQ971324    EFA01226.1    NEVH01005888    PNF38366.1    NEVH01011195    PNF31840.1    GALX01004629    JAB63837.1    GANO01002504    JAB57367.1    GGMR01012631    MBY25250.1    GDHC01021754    JAP96874.1    GEZM01078735    JAV62639.1    GBHO01024993    JAG18611.1    GBHO01024992    JAG18612.1    GEHC01000948    JAV46697.1    GEHC01000961    JAV46684.1    GBHO01012506    JAG31098.1    GALX01005230    JAB63236.1    GBHO01026285    JAG17319.1    ABLF02035279    ABLF02041373    ABLF02025379    ABLF02025385    ABLF02041365    ABLF02057103    LBMM01004455    KMQ92398.1    GDHC01013046    JAQ05583.1    GBRD01016627    JAG49199.1    ABLF02011176    ABLF02041729    ABLF02041632    ABLF02008932    ABLF02008933    GGMR01006639    MBY19258.1    GBHO01030350    GBHO01030349    GBHO01030347    GBHO01030345    JAG13254.1    JAG13255.1    JAG13257.1    JAG13259.1    ABLF02012660    ABLF02012662    AJ009736    CAA08807.1    GEHC01000875    JAV46770.1    GALA01001779    JAA93073.1   
Pfam
PF00078   RVT_1        + More
PF00665   rve
PF17921   Integrase_H2C2
PF17919   RT_RNaseH_2
PF17917   RT_RNaseH
PF00077   RVP
PF01661   Macro
PF12259   Baculo_F
PF00098   zf-CCHC
PF02902   Peptidase_C48
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR036397   RNaseH_sf       
IPR041588   Integrase_H2C2       
IPR000477   RT_dom       
IPR041577   RT_RNaseH_2       
IPR001584   Integrase_cat-core       
IPR012337   RNaseH-like_sf       
IPR041373   RT_RNaseH       
IPR001969   Aspartic_peptidase_AS       
IPR001995   Peptidase_A2_cat       
IPR002589   Macro_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR018061   Retropepsins       
IPR022048   Envelope_fusion-like       
IPR003653   Peptidase_C48_C       
IPR038765   Papain-like_cys_pep_sf       
SUPFAM
SSF53098   SSF53098        + More
SSF50630   SSF50630       
SSF57756   SSF57756       
SSF54001   SSF54001       
Gene 3D
PDB
4OL8     E-value=1.52076e-70,     Score=679

Ontologies

Topology

Length:
810
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00857999999999999
Exp number, first 60 AAs:
0.00839
Total prob of N-in:
0.00046
outside
1  -  810
 
 

Population Genetic Test Statistics

Pi
195.013688
Theta
40.294687
Tajima's D
-1.2718
CLR
140.535547
CSRT
0.0917454127293635
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号