SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15397
Annotation
PREDICTED:_uncharacterized_protein_LOC105841331_[Bombyx_mori]
Location in the cell
Cytoplasmic   Reliability : 2.094
 

Sequence

CDS
ATGAAGACAGTTAAGCGTCTCGCCCGCGATGAAACTGATTTCCCGATCGCTTCAGAAATCGCTAGTGATCATCTTTATATGGATGATCTAGGAGTTTCGGTAGATACGCCCGAGAATGGAATTCAGTTGGCTCATGATTTAATCGAACTATTCAAACGTGGTGGTTTCGACTTAGTTAAATTCGTTAGCAATTCGCCCGAGGTGTTAAAATCGATTCCGCAAGCCAACCGCTTATCTTCAAAAATTGAATTCGACAAGGAGGATAATATGAAGCTCCTAGGTCTAATTTGGTCACCGGTCGAGGATGAATTTTCAATCGCTATTAAATTCAACCCGCAAGCAAAATGTACAAAGCGCCTTATGCTTTCCACAATCGCTAAACTGTGGGACATAAACGGATTTTGTGCCCCTGTCATCTTACACGCAAAATTATTAATAAAAGCTCTCTGGGTAGCTCAGATTGATTGGGATGCAGAGCCTCCAAGCGACATCTGTGCTGCGTGGAAGCGCTTTCTTAATGAACTCCCCGCTCTGCAAGACTTTAAAATACCTCGCTTCGTAGGCATCGTGCCCGAGTCCCGTGTCATACTACTGGGATTTGCGGACGCTTCTGAAAAAGCGATGGGTGCTTCTGTGTATATTTGTGTACAACCGGCTTCCGGACCAAATGAAGTCAATTTAATTGGTGCCAAAAGCAAGGTCGCGCCGCTCAAGGTTATTTCCTTAGCCCGCCTAGAGCTTTGTGCTGCTGTATTATTATCGAAACTGTTTCGATTTGTTATCGACACTGTTTCTCCCCGCTGTCATGTCGACGAAATTTTCGCGTTTACTGATTCGACAGTGACCCTCCATTGA
Protein
MKTVKRLARDETDFPIASEIASDHLYMDDLGVSVDTPENGIQLAHDLIELFKRGGFDLVKFVSNSPEVLKSIPQANRLSSKIEFDKEDNMKLLGLIWSPVEDEFSIAIKFNPQAKCTKRLMLSTIAKLWDINGFCAPVILHAKLLIKALWVAQIDWDAEPPSDICAAWKRFLNELPALQDFKIPRFVGIVPESRVILLGFADASEKAMGASVYICVQPASGPNEVNLIGAKSKVAPLKVISLARLELCAAVLLSKLFRFVIDTVSPRCHVDEIFAFTDSTVTLH

Summary

EMBL
GAIX01013989    JAA78571.1    GEZM01054789    JAV73399.1    GBBI01004276    JAC14436.1    + More
GBHO01044644    JAF98959.1    GBHO01044645    JAF98958.1    GBHO01044643    JAF98960.1    GEBQ01008079    JAT31898.1    GBHO01027393    JAG16211.1    ABLF02004035    ABLF02004036    ABLF02004037    ABLF02004038    ABLF02008018    ABLF02008020    ABLF02012635    ABLF02061171    GEBQ01015458    JAT24519.1    GEBQ01000825    JAT39152.1    GALX01000776    JAB67690.1    GALX01004947    JAB63519.1    APCN01002077    GEBQ01028569    JAT11408.1    GDHC01006469    JAQ12160.1    GEZM01054766    GEZM01054765    JAV73410.1    GBHO01020799    JAG22805.1    JAV73413.1    LBMM01011720    KMQ86668.1    KQ971357    EFA07702.1    GAMC01009674    JAB96881.1    LBMM01012238    KMQ86334.1    GGMR01002024    MBY14643.1    GECZ01008071    JAS61698.1    ABLF02005684    GGMS01011369    MBY80572.1    GDHC01018192    JAQ00437.1    ABLF02025690    LBMM01010886    KMQ87175.1    LBMM01007770    KMQ89434.1    GAMC01021577    GAMC01021573    JAB84982.1    LBMM01010417    KMQ87475.1    GBHO01005525    JAG38079.1    ABLF02006985    GBHO01034255    GBHO01034254    JAG09349.1    JAG09350.1    GGMR01005823    MBY18442.1    GEBQ01004229    JAT35748.1    ABLF02041762    LBMM01009496    KMQ88090.1    LBMM01007366    KMQ89798.1    GFTR01008866    JAW07560.1    GBHO01037676    JAG05928.1    GEBQ01007199    GEBQ01000222    JAT32778.1    JAT39755.1    ABLF02039606    GDHC01019528    JAP99100.1    LBMM01011245    KMQ86943.1    LBMM01011244    KMQ86944.1    DS497760    EFA13225.1    LBMM01005079    KMQ91831.1    GEZM01060254    JAV71154.1    ABLF02026240    ABLF02055027    ABLF02067195    GEBQ01022991    GEBQ01006185    JAT16986.1    JAT33792.1    GGMR01002187    MBY14806.1    GGMS01012864    MBY82067.1    GGMR01003717    MBY16336.1    KQ458473    KPJ05885.1    ABLF02001506    ABLF02008029    ABLF02035899    ABLF02037719    ABLF02046327    ABLF02064627    JYDQ01000959    KRY06068.1    GBHO01039838    GBHO01006034    JAG03766.1    JAG37570.1    GGMR01019938    MBY32557.1    ABLF02018317    GBHO01044316    JAF99287.1    GBHO01020765    GBHO01014531    JAG22839.1    JAG29073.1    LBMM01013710    KMQ85515.1    GDHC01014057    JAQ04572.1    GBHO01044317    GBHO01044315    JAF99286.1    JAF99288.1    LBMM01009863    KMQ87831.1    ABLF02056547    GECZ01006169    JAS63600.1    GEBQ01005223    JAT34754.1    GBHO01033147    JAG10457.1   
Pfam
PF05380   Peptidase_A17        + More
PF17921   Integrase_H2C2
PF18701   DUF5641
PF03564   DUF1759
PF05585   DUF1758
PF00665   rve
PF00078   RVT_1
PF03022   MRJP
PF02945   Endonuclease_7
PF09337   zf-H2C2
Interpro
IPR008042   Retrotrans_Pao        + More
IPR041588   Integrase_H2C2       
IPR012337   RNaseH-like_sf       
IPR040676   DUF5641       
IPR005312   DUF1759       
IPR036397   RNaseH_sf       
IPR008737   Peptidase_asp_put       
IPR001584   Integrase_cat-core       
IPR021109   Peptidase_aspartic_dom_sf       
IPR000477   RT_dom       
IPR036875   Znf_CCHC_sf       
IPR001878   Znf_CCHC       
IPR017996   Royal_jelly/protein_yellow       
IPR011042   6-blade_b-propeller_TolB-like       
IPR029846   Yellow       
IPR001995   Peptidase_A2_cat       
IPR038563   Endonuclease_7_sf       
IPR004211   Endonuclease_7       
IPR001969   Aspartic_peptidase_AS       
IPR000727   T_SNARE_dom       
IPR015416   Znf_H2C2_histone_UAS-bd       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
SSF50630   SSF50630       

Ontologies

Topology

Length:
284
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.869549999999999
Exp number, first 60 AAs:
0
Total prob of N-in:
0.21012
outside
1  -  284
 
 

Population Genetic Test Statistics

Pi
202.484281
Theta
68.231601
Tajima's D
3.225188
CLR
5.102393
CSRT
0.987050647467627
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号