SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15396
Annotation
PREDICTED:_uncharacterized_protein_LOC106138993_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 2.243 Nuclear   Reliability : 2.014
 

Sequence

CDS
ATGGCTCCTAAGAAGAATAATGATAGTGATGAAAGAGAAGACGTTGAGAAGAAAAACGAAGAAGAAAAAATCCCTTACAAGAAAGTGTTATTGAATAGAACAGAGATGGTGGCTTTGATCGATACAGGTAGTGACGCGAATCTTATTAAACATTCAGAATTTGAAAAAATTGAAAATAATATCCAACATTATGACAAGAATTCAGAAGTTCGTCTTACTGGTATTGCTAACAAAGAAATACTTATCAAAGGTGTTTTTACTACTCAGCTACATATTGATAATGCTGTTACTGATATCAAATTTTACATTGTGGAAGATGATATAATACCTGTAAAGCTGATCATTGGCAACCCCATACTGCGTGAATTCGAAGTTAAGTTTACAAGAAATGGTATTGTAATGGAGAAGATACCACTTTGTGCTATTGTTGCAGAGAAGGACGAGGTCAAAGAAGACTACAAGAAATTAAGAAAAGAACATTACAAGAAGTTAGAGACAGAAGATTATAAGAAGTTAGAGAAAGAAGACTGCAAGAAGTTGGTTAAAGTACCTTACCAGAATCATTTGACACAAAATAGAATACTGTACAAAGAGAAGAATGGAAGTAGTTTTATCGCTGTACTAAAGAAGATGGAAAAAGAAATTATAAGAGAGAATCATAGAAGAGGACGACTAAAAGTTGAAGATTGGGAATGGAGGAGGTCCGATACATACGACTAG
Protein
MAPKKNNDSDEREDVEKKNEEEKIPYKKVLLNRTEMVALIDTGSDANLIKHSEFEKIENNIQHYDKNSEVRLTGIANKEILIKGVFTTQLHIDNAVTDIKFYIVEDDIIPVKLIIGNPILREFEVKFTRNGIVMEKIPLCAIVAEKDEVKEDYKKLRKEHYKKLETEDYKKLEKEDCKKLVKVPYQNHLTQNRILYKEKNGSSFIAVLKKMEKEIIRENHRRGRLKVEDWEWRRSDTYD

Summary

Pfam
PF00665   rve        + More
PF00098   zf-CCHC
PF17921   Integrase_H2C2
Interpro
IPR021109   Peptidase_aspartic_dom_sf        + More
IPR036397   RNaseH_sf       
IPR003034   SAP_dom       
IPR001995   Peptidase_A2_cat       
IPR001584   Integrase_cat-core       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR012337   RNaseH-like_sf       
IPR041588   Integrase_H2C2       
SUPFAM
SSF50630   SSF50630        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
239
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00276
Exp number, first 60 AAs:
0.00019
Total prob of N-in:
0.18249
outside
1  -  239
 
 

Population Genetic Test Statistics

Pi
164.83579
Theta
137.226978
Tajima's D
0.632144
CLR
101.421669
CSRT
0.55657217139143
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号