SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15365  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005111
Annotation
FIBH,silk_fibroin_heavy_chain.
Full name
Fibroin heavy chain      
Alternative Name
H-fibroin
Location in the cell
Nuclear   Reliability : 2.164
 

Sequence

CDS
ATGAGAGTCAAAACCTTTGTGATCTTGTGCTGCGCTCTGCAGTATGTCGCTTATACAAATGCAAACATCAATGATTTTGATGAGGACTATTTTGGGAGTGATGTCACTGTCCAAAGTAGTAATACAACAGATGAAATAATTAGAGATGCATCTGGGGCAGTTATCGAAGAACAAATTACAACTAAAAAAATGCAACGGAAAAATAAAAACCATGGAATACTTGGAAAAAATGAAAAAATGATCAAGACGTTCGTTATAACCACGGATTCCGACGGTAACGAGTCCATTGTAGAGGAAGATGTGCTCATGAAGACACTTTCCGATGGTACTGTTGCTCAAAGTTATGTTGCTGCTGATGCGGGAGCATATTCTCAGAGCGGGCCATACGTATCAAACAGTGGATACAGCACTCATCAAGGATATACGAGCGATTTCAGCACTAGTGCTGCAGTCGGTGCAGGAGCTGGTGCAGGTGCTGCCGCTGGTTCTGGTGCGGGTGCCGGAGCTGGTTATGGAGCTGCTTCTGGTGCTGGTGCCGGTGCTGGGGCTGGTGCCGGAGCTGGTTATGGAACTGGTGCAGGTGCAGGTGCCGGAGCTGGTTATGGAGCTGGTGCAGGTGCAGGTGCCGGAGCTGGTTATGGGGCTGGTGCAGGTGCAGGTGCCGGAGCTGGTTATGGAGCTGGTGCAGGTGCAGGTGCCGGAGCTGGTTATGGGGCTGGTGCAGGTGCAGGTGCCGGAGCTGGTTATGGAGCTGGTGCGGGTGCCGGTGCCGGGGCTGGTTATGGAGCTGCCTCTGGTGCTGGTGCTGGCGCTGGGTACGGACAAGGAGTAGGAAGCGGAGCTGCTTCTGGAGCTGGTGCAGGTGCAGGAGCAGGTGCCGGTGCCGGAGCTGGTTATGGAGCTGCCTCTGGTACTGGAGCAGGTTATGGAGCTGGTGCCGGAGCTGGTTACGGAGGTGCCTCTGGTGCTGGTGCTGGTGCCGGTGCTGGGGCTGGAGCCGGTGCTGGTGCAGGTTATGGAACTGGCGCTGGATACGGAGCAGGAGCCGGAGCAGGAGCCGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGATATGGAGTAGGAGCTGGTGCTGGATACGGAGCAGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCCGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCAGGCTCAGGTGCTGGTGCTGGTTCAGGTACTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGTGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCAGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCTGGTTCAGGAGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGTTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCAGAAGTGATGGCTACGAATACGCTTGGTCGTCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGCGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGTTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGTTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGATATGGAGTAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTACTGGTGCAGGCTCAGGTGCTGGTGCTGGTTCAGGATCTGGAGCTGGATACGGAGCAGGAGTTGGTGTTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGAGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCCGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGAGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGTTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCACATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGTTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGTTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTTCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCACATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCTGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGAGCTGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCCGGTGCTGGTTCAGGAGCTGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATATGGAGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCACATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAACTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTTTGGTGCCGGTGCTGGTGCTGGTGCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCTGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACAGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGGGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGGTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTACAGGTGCTGGGGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGCAGGAAGCGGAACTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAACTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGGTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGTAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTGCCGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAATAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTGCCGGTGCTGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGGGCTGGTTCAGGTGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAAATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCGGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGTTGGATACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGCGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTTCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTGCTGGTTCAGGTGCTGGGGCTGGTTCAGGAGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCCGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCGGCTACGAATACGCTTGGTCGTCAGAATCTGACTTTGGAACTGGAAGCGGAGCTGGTGCTGGCTCAGGTGCTGGTGCTGGTTCAGGAGCTGGAGCTGGATACGGAGCAGGAGTTGGTGCTGGTTACGGAGCAGGATATGGAGCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTTCTGGTGCTGGTGCTGGTTCAGGTTCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGATACGGAGCAGGGTACGGAATAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGCTCAGGTGCTGGTGCTGGATACGGAGCAGGGTACGGAGCAGGAGTTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGATATGGAGTAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGCGGAGCTGCCTCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGCGTTGGATACGGAGCAGGAGCTGGCGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCTGGTGCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCTGGAAGCGGAGCTGCCTCTGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTGCTGGTGCCGGTGCTGGTGCTGGTTCAGGAGCTGGTGCTGGTTCAGGAGCTGGTGCTGGATACGGAGCAGGAGCAGGAAGTGGAGCTGCCTCTGGTGCTGGTGCTGGAGCTGGTGCAGGAACAGGCTCTTCTGGATTTGGACCATATGTAGCAAATGGCGGATATAGCAGACGTGAAGGCTACGAATACGCTTGGTCGTCAAAATCTGACTTTGAAACTGGAAGCGGTGCTGCCTCTGGTGCTGGTGCTGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTTCAGGTGCTGGTGCTGGTTCAGGTGCCGGTGCTGGTGGTAGCGTCAGTTACGGAGCTGGCAGGGGATACGGACAAGGTGCAGGAAGTGCAGCTTCCTCTGTGTCATCTGCTTCATCTCGCAGTTACGACTATTCTCGTCGTAACGTCCGCAAAAACTGTGGAATTCCTAGAAGACAACTAGTTGTTAAATTCAGAGCACTGCCTTGTGTGAATTGCTAA
Protein
MRVKTFVILCCALQYVAYTNANINDFDEDYFGSDVTVQSSNTTDEIIRDASGAVIEEQITTKKMQRKNKNHGILGKNEKMIKTFVITTDSDGNESIVEEDVLMKTLSDGTVAQSYVAADAGAYSQSGPYVSNSGYSTHQGYTSDFSTSAAVGAGAGAGAAAGSGAGAGAGYGAASGAGAGAGAGAGAGYGTGAGAGAGAGYGAGAGAGAGAGYGAGAGAGAGAGYGAGAGAGAGAGYGAGAGAGAGAGYGAGAGAGAGAGYGAASGAGAGAGYGQGVGSGAASGAGAGAGAGAGAGAGYGAASGTGAGYGAGAGAGYGGASGAGAGAGAGAGAGAGAGYGTGAGYGAGAGAGAGAGAGAGYGAGAGAGYGAGYGVGAGAGYGAGYGAGAGSGAASGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGTGAGSGAGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGAGAGYGAGAGAGYGAGAGVGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGVGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVANGGYSRSDGYEYAWSSDFGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGVGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGVGSGAGAGSGAGAGSGAGAGYGAGAGAGYGAGAGAGYGAGYGVGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGTGAGSGAGAGSGSGAGYGAGVGVGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGSGAGAGSGAGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGVGYGAGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVAHGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGVGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGVGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVANGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVAHGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGYGAGAGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVAHGGYSGYEYAWSSESDFGTGSGAGAGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGTGSGAGAGSGAGAGYGAGVGAGYGAGAGSGAAFGAGAGAGAGAGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVANGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYRAGVGAGYGAGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGYGVGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGVGAGYGAGAGSGAASGAGAGSGAGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGAGSGAGAGTGAGAGSGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVANGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGAGSGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGVGAGYGVGYGAGAGAGYGVGYGAGAGAGYGAGAGSGTGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGYGVGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGAGAGYGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGVGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVANGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGSGAGAGSGAGAGAGSGAGAGYGAGYGIGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGAGAGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVNGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGVGVGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGSGSGAGSGAGAGSGAGAGSGAGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGAGSGAASGAGAGAGAGAGTGSSGFGPYVANGGYSGYEYAWSSESDFGTGSGAGAGSGAGAGSGAGAGYGAGVGAGYGAGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGSGSGAGAGSGSGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGYGIGVGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGYGAGAGVGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGYGAGYGAGVGAGYGAGAGVGYGAGYGVGAGAGYGAGAGSGAASGAGAGSGAGAGSGAGAGSGAGAGSGAGAGSGAGSGAGAGYGAGAGVGYGAGAGAGYGAGAGSGAASGAGAGAGAGSGAGAGSGAGAGSGAGSGAGAGSGAGAGYGAGAGSGAASGAGAGSGAGAGAGAGAGAGSGAGAGSGAGAGYGAGAGSGAASGAGAGAGAGTGSSGFGPYVANGGYSRREGYEYAWSSKSDFETGSGAASGAGAGAGSGAGAGSGAGAGSGAGAGSGAGAGGSVSYGAGRGYGQGAGSAASSVSSASSRSYDYSRRNVRKNCGIPRRQLVVKFRALPCVNC

Summary

Subunit
Silk fibroin elementary unit consists in a disulfide-linked heavy and light chain and a p25 glycoprotein in molar ratios of 6:6:1. This results in a complex of approximately 2.3 MDa.
Keywords
3D-structure   Complete proteome   Direct protein sequencing   Disulfide bond   Reference proteome   Repeat   Signal   Silk protein  
Feature
chain  Fibroin heavy chain
Uniprot
ProteinModelPortal
PDB
3UA0     E-value=1.25668e-65,     Score=644

Ontologies

GO

Topology

SignalP
Position:   1 - 21,         Likelihood:  0.982750
 
 
Length:
5231
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
350.46933
Exp number, first 60 AAs:
1.22612
Total prob of N-in:
0.77112
outside
1  -  5231
 
 

Population Genetic Test Statistics

Pi
34.35855
Theta
148.680199
Tajima's D
1.154151
CLR
1.667505
CSRT
0.705164741762912
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
20029844 VITTDSDGNESIVEEDVLM*KTL 96.88 8e-11
20029844 VITTDSDGNESIVEEDVLM*KTL 96.88 8e-11
20029844 VITTDSDGNESIVEEDVLM*KTL 96.88 8e-11
31253818 mIKTFVITTDSDGNESIVEEDVLmK 100.00 9e-10
31253818 DASGAVIEEEITTKKmQR 100.00 9e-10
31253818 EGYEYAWSSK 100.00 9e-10
31253818 REGYEYAWSSK 100.00 9e-10
30270257 EGYEYAWSSK 100.00 9e-10
30270257 REGYEYAWSSK 100.00 9e-10
27102218 NHGIIGKNEK 96.00 2e-09
20029844 DVLM*KTLSDGTVAQSY 100.00 2e-09
20029844 MKTLSDGTVAQSY 100.00 2e-09
27530593 RAIVGASLSDIMAKR 100.00 5e-09
20029844 TFVITTDS*DGNESIVEEDVLMK 100.00 2e-08
20029844 TLSDGTVAQSYVAADAGAYSQ 100.00 2e-08
20029844 TFVITTDSDGNES*IVEEDVLM*K 100.00 2e-08
20029844 TLSDGTVAQSYVAADAGAYSQ 100.00 2e-08
31253818 TFVITTDSDGNESIVEEDVLmK 100.00 1e-07
31253818 ALPcVNc 100.00 1e-07
31253818 TFVITTDSDGNESIVEEDVLmK 100.00 1e-07
31253818 DASGAVIEEQITTKKmQR 100.00 1e-07
30270257 TFVITTDSDGNESIVEEDVLmK 100.00 1e-07
30270257 DASGAVIEEQITTKKmQR 100.00 1e-07
20029844 DASGAVIEEQITTKK 100.00 1e-07
20029844 DASGAVIEEQ*ITTK 100.00 1e-07
20029844 DAS*GAVIEEQITTK 100.00 1e-07
20029844 DAS*GAVIEEQITTK 100.00 1e-07
20029844 FVITTDSDGNESI 100.00 2e-07
20029844 DAGAYSQSGPYVSNSGYSTHQGYTSD 100.00 2e-07
20029844 VITTDSDGNESIVEEDVLM 100.00 2e-07
20029844 VITTDSDGNESIVEEDVLM 100.00 2e-07
20029844 VITTDSDGNESIVEEDVLM 100.00 2e-07
20029844 VITTDSDGNESIVEEDVLM* 100.00 2e-07
25860555 SGNFAGFR 95.45 2e-07
24093152 TFTEEQIR 95.45 2e-07
27102218 NHGIIGK 95.45 2e-07
20029844 VIEEQITTK 96.00 2e-07
20029844 TFVITTDSDGNESIVEEDVLMK 100.00 5e-07
20029844 TFVITTDSDGNE*SIVEEDVLMK 100.00 5e-07
20029844 TFVITTDSDGNESIVEE*DVLMK 100.00 5e-07
20029844 TFVITTDSDGNESIVEEDVLMK 100.00 5e-07
20029844 TFVITTDSDGNESIVEEDVLM*K 96.15 1e-06
20029844 DAGAYSQSGPYVSNSGYSTHQGYTSD 100.00 1e-06
20029844 SGAVIEEQITTK 100.00 4e-06
20029844 IKTFVITTDSDGNES*IVEEDVLMK 100.00 4e-06
20029844 VITTDSDGNESIVEEDVL 100.00 4e-06
20029844 TFVITTDSDGN*ESIVEEDVLM*K 95.65 4e-06
20029844 TFVITTDSDGNESIVEEDVLMK 95.65 4e-06
20029844 TFVITTDSDGNESIVEEDVLMK 95.65 4e-06
20029844 VITTDSDGNESIVEEDVLMKTL 95.65 9e-06
20029844 VITTDSDGNESIVEEDVLMKTL 95.65 9e-06
20029844 VITTDSDGNESIVEEDVLMKTL 95.65 9e-06
20029844 VITTDSDGNESIVEEDVLMKTL 95.65 9e-06
20029844 TLSDGTVAQSYVAADAGAYSQSGPY 100.00 2e-05
20029844 TFVITTDSDGNESIVEEDVLM*K 100.00 2e-05
20029844 VITTDSDGNESIVEEDVL 100.00 2e-05
20029844 VITTDSDGNESIVEEDVL 100.00 2e-05
20029844 VITTDSDGNESIVEEDVL 100.00 2e-05
20029844 VITTDSDGNESIVEEDVLM 100.00 2e-05
20029844 VITTDSDGNESIVEEDVL 100.00 2e-05
20029844 VITTDSDGNESIVEEDVLMK 100.00 2e-05
20029844 TFVITTDSDGNESIVEEDVLM*K 95.45 2e-05
20029844 TFVITTDSDGNESIVEEDVLM*K 95.45 2e-05
20029844 VITTDSDGNESIVEEDVLMK 100.00 5e-05
31253818 GYGQGAGSAASSVSSASSR 100.00 8e-05
30270257 GYGQGAGSAASSVSSASSR 100.00 8e-05
24093152 DASGAVIEEQITTKK 100.00 8e-05
20029844 NINDFDEDYFGSDVTVQ 100.00 1e-04
20029844 NINDFDEDYFGSDVTVQ 100.00 1e-04
20029844 NIN*DFDEDYFGSDVTVQ 100.00 1e-04
20029844 SGAVIEEQITTK 100.00 1e-04
20029844 NIN*DFDEDYFGSDVTVQ 100.00 1e-04
20029844 S*GAGAGYGAGYGAGAGAGY 100.00 1e-04
20029844 S*GAGAGYGAGYGAGAGAGY 100.00 1e-04
20029844 S*GAGAGYGAGYGAGAGAGY 100.00 1e-04
20029844 S*GAGAGYGAGYGAGAGAGY 100.00 1e-04
20029844 S*GAGAGYGAGYGAGAGAGY 100.00 1e-04
20029844 VIEEQITTK 100.00 3e-04
20029844 VITTDSDGNESIVEEDVLM*K 100.00 3e-04
20029844 GYGQGAGSAASSVSSASSR 100.00 5e-04
20029844 GYGQGAGSAASSVSSASSR 100.00 5e-04
20029844 GYGQGAGSAASSVSSASSR 100.00 5e-04
20029844 GYGQGAGSAASSVSSASSR 100.00 5e-04
20029844 TTDSDGNESIVEEDVLMK 100.00 0.001
20029844 TDSDGNESIVEEDVLMK 100.00 0.006
20029844 NINDFDEDYFGSD 100.00 0.008
20029844 NINDFDEDY 100.00 0.036
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号