SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15347
Pre Gene Modal
BGIBMGA005124
Annotation
PREDICTED:_serine/threonine-protein_phosphatase_2A_56_kDa_regulatory_subunit_gamma_isoform_isoform_X1_[Bombyx_mori]
Full name
Serine/threonine protein phosphatase 2A regulatory subunit       + More
Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit      
Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform      
Alternative Name
PP2A B subunit isoform B'-gamma
PP2A B subunit isoform B56-gamma
PP2A B subunit isoform PR61-gamma
PP2A B subunit isoform R5-gamma
Renal carcinoma antigen NY-REN-29
PP2A B subunit isoform B'-alpha-3
Location in the cell
Mitochondrial   Reliability : 1.422 Nuclear   Reliability : 1.956
 

Sequence

CDS
ATGGTTGCGAGGGGACGGCAGAAGACGGCGCGCATGTGCGGCGAGTACGGTGTGCGCAGCGCGTGTCAGTCCAGCCGCCCCGCAGCTCGCACCGGTCCCGGCGCTGCCGGGCTCCCGCTCGGATGCCGCTGCCGGCTACCGCTTGCGATGGTCCACGCCGGGCCGGCCGTGCGCGCGCCCTCTCGCGCGATGTTCGCCGCCGCCGATACTAAACCGCGTCGCGCCGTCTCGCCTCTTGGTATACCGAAATCTCCTTCGTTCCACTCTGGACTTGATCTCGTCGCGAATCAAGCGACAACTAAGCGCTCCGAAAGCGTATCGGACGTCGCCAGAGCCTTTCGGTTTGCGTTGTTCGCCGGCATGGAGGGCCAGGGCCCGCCGCAGAAGGCGCCTTCGCCGCCCGATGCGCGGAGCCCGCCGCCCCCCGTCTCTGCCGCTGTATCACCCGATCGTCCCGTGCTGGTGATACCTAATATTGATAGAGAGAGTCTAATGGAGCAGTTGCCACTGCTGAAAGATGCACCCGCGGCAGAAAAAGAACAGCTCTTCGTGCAGAAGCTGCGGCAGTGCTGTCTGCTGTTCGACTTTGCGGACGAGCCACTGTCTGATCTCAAATGGAAGGAGGTGAAGAGGGCCGCGCTGCTCGAGATGGTCGAATACGTCACGTCGCAGCGAGGCGTCATCACCGACTCTATTTACCCTGAAGCCGTTAATATGTTCGCGATCAATCTATTCCGGACGTTGCCGCCATCGTCGAATCCTAACGGAGCGGAATTCGATCCAGAGGAGGACGAACCCACATTAGAGGCCGCCTGGCCGCATTTACAGCTCGTCTACGAACTGTTCCTGCGGTTACTCGAGTCTCCGGATTTTCAGCCAAACATTGCCAAGAAGTATATAGACCAGAAGTTTGTTTTGCAACTCTTGGAGTTGTTCGATTCTGAGGACCCACGCGAACGAGACTTCCTCAAAACAACTCTCCATAGGATATACGGGAAATTCTTAGTTCTACGCGCTTACATAAGGAAACAGATCAATAACGTATTCTATAGGTTTATTTATGAAACGGAACACCATAATGGCATCGCGGAGCTCCTCGAAATCCTTGGTTCCATCATCAATGGATTCGCGTTGCCTCTCAAAGAGGAACACAAATTATTCTTACTCAGGGTACTACTGCCGCTGCACAAGGCCAAGTCGCTGTCGGTGTACCACCCGCAGCTGGCGTACTGCGTCGTGCAGTTCCTCGAGAAGGACCCCTCCCTCACGCAGCCCGTCGTCAGAGCTCTCTTGAAGTACTGGCCGAAGACTCATTCGCCGAAGGAGGTTATGTTCTTGAACGAGATGGAGGAGATATTGGACGTGGTGGAACCGGCCGAGTTCCAGCGCATCATGGACCCGCTGTTCAAGCAGCTAGCCAAATGTGTCTCCAGTCCGCATTTCCAGGTAGCAGAACGAGCGCTCTACTACTGGAACAACGAATACATAATGTCTTTAATATCGGACAACGCGACCCACATCCTGCCCGTGATGTTTCCGGCGTTGTACCGGAACACAAAGAGCCACTGGAACAAGACGATACACGGGCTCGTGTACAACGCGCTCAAACTGTTCATGGAGATGAATCAGAAACTGTTCGACGAGTGCACGCAGCAGTACAAGCAGGAGAAACAGAAAGAGAGGGAGCGACTTCTGCAGCGAGAGGAGATCTGGCAGCAAATAGAGGAGAGGGCGCAACGAAACGACCGCGGCTCAGAGCCCGCCGAGACACGCAAGCAGACCTATAGTAACGCGAACAAGCCCCTCCTCCGCAAGAAATCGGAGCTGCCCGTGGACAGCAGCGCCGTGCGCGCGCTCGCCGAGCACCGGCGCGCCGACCCCTTCCTGTCCTCGCCGCCCGACATCAACCACTGCTAG
Protein
MVARGRQKTARMCGEYGVRSACQSSRPAARTGPGAAGLPLGCRCRLPLAMVHAGPAVRAPSRAMFAAADTKPRRAVSPLGIPKSPSFHSGLDLVANQATTKRSESVSDVARAFRFALFAGMEGQGPPQKAPSPPDARSPPPPVSAAVSPDRPVLVIPNIDRESLMEQLPLLKDAPAAEKEQLFVQKLRQCCLLFDFADEPLSDLKWKEVKRAALLEMVEYVTSQRGVITDSIYPEAVNMFAINLFRTLPPSSNPNGAEFDPEEDEPTLEAAWPHLQLVYELFLRLLESPDFQPNIAKKYIDQKFVLQLLELFDSEDPRERDFLKTTLHRIYGKFLVLRAYIRKQINNVFYRFIYETEHHNGIAELLEILGSIINGFALPLKEEHKLFLLRVLLPLHKAKSLSVYHPQLAYCVVQFLEKDPSLTQPVVRALLKYWPKTHSPKEVMFLNEMEEILDVVEPAEFQRIMDPLFKQLAKCVSSPHFQVAERALYYWNNEYIMSLISDNATHILPVMFPALYRNTKSHWNKTIHGLVYNALKLFMEMNQKLFDECTQQYKQEKQKERERLLQREEIWQQIEERAQRNDRGSEPAETRKQTYSNANKPLLRKKSELPVDSSAVRALAEHRRADPFLSSPPDINHC

Summary

Description
The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment.
The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. The PP2A-PPP2R5C holoenzyme may specifically dephosphorylate and activate TP53 and play a role in DNA damage-induced inhibition of cell proliferation. PP2A-PPP2R5C may also regulate the ERK signaling pathway through ERK dephosphorylation.
The B regulatory subunit might modulate substrate selectivity and catalytic activity, and also might direct the localization of the catalytic enzyme to a particular subcellular compartment. The PP2A-PPP2R5C holoenzyme may activate TP53 and play a role in DNA damage-induced inhibition of cell proliferation. PP2A-PPP2R5C may also regulate the ERK signaling pathway through ERK dephosphorylation (By similarity).
Subunit
PP2A consists of a common heterodimeric core enzyme, composed of PPP2CA a 36 kDa catalytic subunit (subunit C) and PPP2R1A a 65 kDa constant regulatory subunit (PR65 or subunit A), that associates with a variety of regulatory subunits. Proteins that associate with the core dimer include three families of regulatory subunits B (the R2/B/PR55/B55, R3/B''/PR72/PR130/PR59 and R5/B'/B56 families), the 48 kDa variable regulatory subunit, viral proteins, and cell signaling molecules. Interacts with PPP2CA AND PPP2R1A; the interaction is direct. Interacts with SGO1; the interaction is direct. Isoform 1 and isoform 2 interact with TP53 (phosphorylated at Ser-15 by ATM); increased upon DNA damage it drives PP2A-mediated dephosphorylation of TP53 at Thr-55. Interacts with IER3 and/or ERK kinases; regulates ERK dephosphorylation. Interacts with CIP2A; this interaction stabilizes CIP2A (PubMed:28174209).
PP2A consists of a common heterodimeric core enzyme, composed of PPP2CA a 36 kDa catalytic subunit (subunit C) and PPP2R1A a 65 kDa constant regulatory subunit (PR65 or subunit A), that associates with a variety of regulatory subunits. Proteins that associate with the core dimer include three families of regulatory subunits B (the R2/B/PR55/B55, R3/B''/PR72/PR130/PR59 and R5/B'/B56 families), the 48 kDa variable regulatory subunit, viral proteins, and cell signaling molecules. Interacts with SGO1 (By similarity). Interacts with SGO1; the interaction is direct. May interact with TP53 (By similarity). Interacts with IER3 and/or ERK kinases; regulates ERK dephosphorylation (By similarity). Interacts with CIP2A; this interaction stabilizes CIP2A (By similarity).
Similarity
Belongs to the phosphatase 2A regulatory subunit.
Belongs to the phosphatase 2A regulatory subunit B56 family.
Keywords
3D-structure   Acetylation   Alternative splicing   Centromere   Chromosome   Complete proteome   Nucleus   Phosphoprotein   Polymorphism   Reference proteome  
Feature
chain  Serine/threonine-protein phosphatase 2A 56 kDa regulatory subunit gamma isoform
splice variant  In isoform 4.
sequence variant  In dbSNP:rs3742424.
EMBL
BABH01019765    BABH01019766    BABH01019767    ODYU01010346    SOQ55388.1    AGBW02011239    + More
OWR46988.1    KQ459324    KPJ01487.1    RSAL01000152    RVE45736.1    KY363352    ARS43574.1    GEZM01062592    JAV69601.1    GECZ01024648    GECZ01016200    JAS45121.1    JAS53569.1    NEVH01022633    PNF18810.1    KQ971354    KYB26383.1    GEDC01013996    JAS23302.1    GEDC01031653    JAS05645.1    GEZM01062595    JAV69598.1    DS235199    EEB13150.1    GEZM01062591    JAV69602.1    APGK01036460    APGK01036461    KB740940    KB632083    ENN77685.1    ERL88616.1    GCES01032601    JAR53722.1    U37352    Z69030    AK131391    AK302470    AB451341    AL118558    AL137779    CH471061    D26445    L42375    CABD030094108    CABD030094109    CABD030094110    CABD030094111    CABD030094112    AJFE02020155    AJFE02020156    AJFE02020157    AJFE02020158    AJFE02020159    AJFE02020160    AJFE02020161    AJFE02020162    AJFE02020163    AJFE02020164    NBAG03000028    PNI97255.1    NDHI03003534    PNJ26283.1    JSUE03040466    JSUE03040467    JU335293    AFE79046.1    GEBF01003681    JAN99951.1    GAMT01002688    GAMR01009254    JAB09173.1    JAB24678.1    ACTA01068517    ACTA01076517    ACTA01084517    ACTA01092517    AANG04004659    ADFV01092964    ADFV01092965    ADFV01092966    ADFV01092967    ADFV01092968    ADFV01092969    ADFV01092970    ADFV01092971    ADFV01092972    ADFV01092973    CR381646    BC139635    AAI39636.1    GL193486    EFB22885.1    GABZ01005427    JAA48098.1    RJVU01018862    ROL51286.1    CM001282    EHH63898.1    AAEX03006020    BC063910    CR848574    AAH63910.1    CAJ81484.1    BC003979    AB055635    AB055636    U37353    U59418    AY389498   
Pfam
PF01603   B56
Interpro
IPR011989   ARM-like        + More
IPR002554   PP2A_B56       
IPR016024   ARM-type_fold       
SUPFAM
SSF48371   SSF48371       
Gene 3D
PDB
2NPP     E-value=0,     Score=1789

Ontologies

Topology

Subcellular location
Nucleus  
Chromosome  
Centromere  
Length:
638
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05497
Exp number, first 60 AAs:
0.00706
Total prob of N-in:
0.00418
outside
1  -  638
 
 

Population Genetic Test Statistics

Pi
246.454836
Theta
178.169649
Tajima's D
1.673809
CLR
0.226227
CSRT
0.817859107044648
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号