SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15332
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Full name
Guanylate cyclase      
Location in the cell
Mitochondrial   Reliability : 2.575
 

Sequence

CDS
ATGAAGTCCTTGCGACACGACCTACGCTCCTTTATTACTCAGCGTATCAAAGAGACGATTGAGCGAAACCAAGGCTCTAAAGTATTCGCAAGAGACGCTTCTATTAGGCAAAGCCAGCTGACGAAGCTGAAGACCGAAGATGGACGTGTAACGTCGAATAAGTCAGAGGTCCTGCGGGAGATAGAGAGGTTCTACGGGCAGCTGTTTACCTCGGTCTCAGCTGAACCGCAAGGTTTAGCTGCAGACCCTAGAGCCAAGCTAACCCGACACTACACCGAAGACATCCCGGACTTCAGCCTGTACGAGATTAGGATGGCTCTCAAACAGCTTAAGAATAACAAGGCACCGGGCGAGGATGGAATTACTACGGAGCTTCTGAAAGCGGGCGGGACGCCGGTACTGAAAGTCCTTCAGAAGCTCTTCAATTCCTCTTTGCTCGATGGAAAACCGCCACAGGCATGGAACAGGGGTGTTGTGATCCTGTTCTTCAAAAAAGGTGACAAAACCTTATTGAAGAACTATAGGCCCATAGCACTGCTGAGCCATGTCTACAAGCTGTTCTCGAGAGTCATCACGAAGCGTCTCGAACGCAGTACCATAGACCACATACATACGCTGCGGCAGATTGTACAGAAGACCGAAGAGTACAATCGGCCATTATGCTTAGCGTTTGTGGACTATGAGAAAGCCTTTGATTCCGTCGAAACATGGGCGGTCCTTAGATCTCTCCAGCGGTGCCGTATTGACCACCGGTATATCGAAGTATTGAAGTGTTTGTATAATAACGCCACCATGTCAGTCCGAGTACAGGAGCATTGCACGAAGGAAATCCCTGTAAAGAGAGGAGTGAGACAGGGAGATGTGATATCTCCGAAACTGTTTATCACTGCTCTGGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGACTTGGCATCAATATTAACGGCGAATACATCACTCATCTTCGGTTTGCCGATGACATCGTGGTCATGGCAGAGTCGCTGGAAGATTTAGGGCGTATGCTCGGACAGGCAGTCCGATTAGGTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGCTGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGCCTTAAGACAAAGGCGTACAACCAATGTGTGTTACCAGTGATGACTTACGGCTCGGAGATCACTAGGAATCTTTTTAGAAGGCTCAAAGTCGCGCAGCGAGCTATGGAGAGGGCTATGCTCGGCATTTCTCTACGTGATCGAATCCGAAATGAGGAGATCCGTAGAAGAACGAAGGTTGCTGACATAGCCCGTAGAATTAGTGAACTGAAGTGGCAATGGGCCGGCCACATAGCACGAAGAGAGGACGGTCGATGGGGCAGAAGGATCCTGGAGTGGCGACCACGTACTGGCAAGCGCAGTGTGGGAAGGCCACCTACTAGATGGACCGACGACCTAGTAAAAAGCGCCGGGTCTCGTTGGATGCAGGTGGCAATGGACCGGTCGCACTGGAAATCTATTGGAGAGGCCTATGTTCAGCAGTGGACGGCGATAGGCTGA
Protein
MKSLRHDLRSFITQRIKETIERNQGSKVFARDASIRQSQLTKLKTEDGRVTSNKSEVLREIERFYGQLFTSVSAEPQGLAADPRAKLTRHYTEDIPDFSLYEIRMALKQLKNNKAPGEDGITTELLKAGGTPVLKVLQKLFNSSLLDGKPPQAWNRGVVILFFKKGDKTLLKNYRPIALLSHVYKLFSRVITKRLERSTIDHIHTLRQIVQKTEEYNRPLCLAFVDYEKAFDSVETWAVLRSLQRCRIDHRYIEVLKCLYNNATMSVRVQEHCTKEIPVKRGVRQGDVISPKLFITALEDSFKLLEWQGLGININGEYITHLRFADDIVVMAESLEDLGRMLGQAVRLGRSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKAYNQCVLPVMTYGSEITRNLFRRLKVAQRAMERAMLGISLRDRIRNEEIRRRTKVADIARRISELKWQWAGHIARREDGRWGRRILEWRPRTGKRSVGRPPTRWTDDLVKSAGSRWMQVAMDRSHWKSIGEAYVQQWTAIG

Summary

Catalytic Activity
GTP = 3',5'-cyclic GMP + diphosphate
EC Number
4.6.1.2
EMBL
FJ265543    ADI61811.1    FJ265544    ADI61812.1    FJ265549    ADI61817.1    + More
FJ265542    ADI61810.1    RSAL01002362    RVE40503.1    FJ265550    ADI61818.1    FJ265551    ADI61819.1    FJ265545    ADI61813.1    RSAL01002130    RVE40575.1    EF113398    EF113401    ABO45231.1    EF113402    ABO45239.1    KZ150072    PZC74016.1    KZ149985    PZC75698.1    MRZV01002136    PIK34564.1    AAGJ04050748    MRZV01000899    PIK42833.1    FJ265562    ADI61830.1    GBGD01000453    JAC88436.1    FJ265561    ADI61829.1    GBBI01004877    JAC13835.1    GDKW01001596    JAI54999.1    FJ265564    ADI61832.1    KZ150108    PZC73382.1    JARK01001389    EYC11015.1    JARK01001639    EYB85201.1    JARK01001655    EYB84321.1    FJ265563    ADI61831.1    KZ150317    PZC71439.1    JARK01001362    EYC18844.1    EYC18843.1    JARK01001568    EYB89432.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    ODYU01004088    SOQ43598.1    JARK01001517    EYB93530.1    KZ149907    PZC78256.1    JARK01001378    EYC13977.1    JARK01001406    EYC07496.1    EYC28635.1    JARK01001630    EYB85641.1    JARK01001424    EYC04315.1    EYC04317.1    EYC04316.1    JARK01001531    EYB92324.1    EYC04314.1    JARK01001346    EYC26784.1    JARK01001344    EYC28218.1    JARK01001438    EYC02012.1    JARK01001349    EYC24735.1    JARK01000063    EYC44387.1    JARK01000077    EYC43894.1    JARK01001380    EYC13322.1    JARK01001470    JARK01000204    EYB98082.1    EYC40602.1    JARK01001361    EYC19034.1    EYB98081.1    EYC40601.1    JARK01001365    EYC18010.1    JARK01001338    EYC33297.1    JARK01001407    EYC07212.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    EYC18009.1    EYC10874.1    EYC28216.1    JARK01001372    EYC15614.1    JARK01001421    EYC04912.1    JARK01001612    EYB86585.1    JARK01001497    EYB95322.1    JARK01001581    EYB88505.1    JARK01000109    EYC42952.1    JARK01001340    EYC30744.1    EYC31302.1    EYC26445.1    JARK01000165    EYC41537.1    JARK01000161    EYC41641.1    JARK01001401    EYC08686.1    EYB95049.1    JARK01001582    EYB88498.1    JARK01001475    EYB97550.1    JARK01000008    EYC46079.1    JARK01001341    EYC30223.1    EYC29807.1    JARK01001502    EYB94855.1    EYC31295.1    JARK01001618    EYB86258.1    JARK01000256    EYC39462.1    JARK01000302    EYC38674.1    JARK01000248    EYC39628.1    JARK01000177    EYC41209.1    EYC41210.1    EYC03125.1    JARK01001388    EYC11165.1    JARK01001351    EYC23395.1    JARK01001677    EYB83167.1    JARK01000173    EYC41342.1    EYB83168.1    JARK01001357    EYC20551.1    EYB86256.1    JARK01001342    EYC29360.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF01826   TIL
PF01094   ANF_receptor
PF07714   Pkinase_Tyr
PF00211   Guanylate_cyc
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR036084   Ser_inhib-like_sf       
IPR002919   TIL_dom       
IPR001828   ANF_lig-bd_rcpt       
IPR001245   Ser-Thr/Tyr_kinase_cat_dom       
IPR011009   Kinase-like_dom_sf       
IPR001170   ANPR/GUC       
IPR001054   A/G_cyclase       
IPR028082   Peripla_BP_I       
IPR000719   Prot_kinase_dom       
IPR029787   Nucleotide_cyclase       
IPR017452   GPCR_Rhodpsn_7TM       
SUPFAM
SSF56219   SSF56219        + More
SSF57567   SSF57567       
SSF53822   SSF53822       
SSF55073   SSF55073       
SSF56112   SSF56112       
Gene 3D

Ontologies

Topology

Length:
527
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00268
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00267
outside
1  -  527
 
 

Population Genetic Test Statistics

Pi
7.629692
Theta
11.635932
Tajima's D
-0.727988
CLR
1551.959698
CSRT
0.191740412979351
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号