SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15314  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA005058
Annotation
Na?K-ATPase_alpha-subunit_[Bombyx_mori]
Full name
Sodium/potassium-transporting ATPase subunit alpha      
Alternative Name
Sodium pump subunit alpha
Location in the cell
PlasmaMembrane   Reliability : 3.589
 

Sequence

CDS
ATGGGCGAGACGCGCAGAAAACCTCCCGCGAAAAAACGGAAACCAGGAGATTTAGAAGATCTCAAACAGGAGCTGGATATTGATTACCATAAAGTCACTCCTGAGGAACTCTACCAAAGATTTCAAACGCACCCGGAAAATGGCCTTAGTCACGCAAAAGCGAAAGAGAACTTAGAAAGAGACGGCCCCAATGCTCTTACACCACCTAAACAAACACCCGAATGGGTGAAGTTTTGTAAAAATCTATTCGGCGGCTTTGCATTGTTACTCTGGATTGGTGCTATTCTATGCTTTATCGCCTACGGTATTCAGGCTAGTACCGTAGAGGAGCCCGCTGATGACAATCTGTACCTGGGCATCGTGCTCGCGGCCGTCGTGATCGTTACTGGTATCTTCTCGTACTACCAAGAGAGCAAGTCGTCTAAAATCATGGAATCTTTCAAGAACATGGTCCCCCAATTCGCCACCGTCATCCGTGAAGGAGAGAAACTTACGCTCCGAGCCGAGGACCTGGTGCTTGGTGATATTGTCGAGGTTAAATTCGGTGACCGGATTCCCGCCGACATCCGTATTATCGAAGCGCGAGGCTTTAAAGTCGACAACTCTAGCTTGACCGGCGAATCTGAACCCCAATCCCGAGGAGCCGAATTCACAAATGAGAACCCACTCGAGACCAAGAACTTGGCCTTCTTCTCGACCAACGCCGTTGAGGGTACCGCTAAAGGAATAGTCATCTGCTGTGGAGACAATACTGTGATGGGCCGCATTGCTGGTCTCGCTTCCGGTCTGGACACTGGTGAAACTCCGATCGCTAAGGAGATCCATCACTTTATTCATCTTATCACCGGCGTGGCTGTCTTCCTCGGAGTGACTTTCTTCGTTATTGCTTTCATTCTCGGATACCACTGGCTCGACGCTGTCATCTTCCTCATCGGTATCATCGTAGCTAACGTGCCTGAAGGGCTCTTGGCCACCGTGACTGTGTGCTTGACTCTCACTGCCAAACGAATGGCTTCCAAGAACTGCCTGGTCAAGAATCTCGAAGCCGTCGAAACTCTGGGTTCCACTTCCACGATTTGCTCCGACAAAACCGGAACCCTCACTCAGAACAGAATGACTGTTGCTCACATGTGGTTCGACAACCAGATCATTGAAGCTGATACAACTGAAGATCAATCCGGCGTACAGTACGACCGCACTAGCCCTGGCTTCAAGGCTCTTGCCAAAATTGCTTCGCTCTGCAACCGAGCTGAGTTCAAGGGTGGTCAGGATGGTGTTCCGATTCTGAAGAAGGAAGTCGCCGGTGACGCCTCTGAAGCCGCTTTACTGAAATGCATGGAGCTGGCTCTCGGTGATGTCTTGTCGATCAGGAAGCGCAACAAGAAAGTCTGCGAAATTCCCTTCAACTCTACTAACAAGTACCAGGTATCGATCCACGAGAGCGACGACCCCAGCGACCCCCGCCACCTGCTGGTGATGAAGGGAGCACCCGAAAGAATCCTGGAACGTTGTAGCACTATCTTCATTGGCGGAAAGGAAAAGGTATTAGACGAGGAAATGAAGGAGGCGTTCAACAACGCTTACCTTGAACTCGGTGGTCTTGGCGAGCGTGTGCTCGGCTTCTGCGACCTTCAGCTGCCCTCCGACAAGTACCCCATCGGCTACAAGTTCAACACTGACGACCCTAACTTCCCCTTGGACAACTTGCGCTTTGTTGGTCTGATGAGCATGATTGATCCTCCCCGCGCTGCTGTACCAGATGCCGTGGCCAAGTGCCGCTCCGCCGGTATCAAGGTTATCATGGTAACCGGAGACCACCCCATCACTGCCAAGGCTATTGCCAAATCTGTAGGTATAATTTCTGAAGGTAACGAGACCGTAGAGGACATTGCTGCGCGCTTGAATATCCCCGTTTCCGAGGTGAATCCCCGCGAAGCCAAAGCCGCTGTCGTCCACGGAACCGAGCTCCGCGAACTGAACTCCGACCAGCTCGATGAGATCCTCAAGTTCCACACCGAAATCGTGTTCGCCCGCACCTCCCCGCAACAGAAGTTGATCATCGTTGAGGGTTGCCAGCGTCTCGGCGCCATCGTGGCTGTGACCGGCGACGGTGTCAACGACTCGCCCGCCCTCAAGAAGGCCGACATCGGTGTCGCTATGGGTATCGCCGGCTCCGACGTTTCCAAGCAGGCCGCTGACATGATTCTACTCGACGACAACTTCGCGTCCATCGTGACCGGTGTCGAAGAAGGCCGACTGATCTTTGACAACTTGAAGAAGTCAATCGCCTACACCCTAACCTCGAACATTCCAGAAATCTCCCCCTTCCTTGCCTTCATCCTTTGCGACATTCCTCTGCCCCTGGGTACAGTAACCATCCTCTGCATCGATCTGGGAACGGACATGGTGCCTGCTATATCATTGGCGTACGAGGCGCCCGAGTCTGATATCATGAAGCGGCAGCCGCGGGACCCTTACCGCGACAACCTCGTCAACAGAAGGTTGATCTCTATGGCTTACGGACAAATCGGAATGATCCAAGCCGCGGCTGGCTTCTTCGTCTACTTCGTGATCATGGCTGAAAACGGATTCCTCCCGATGAAGCTTTTCGGTATCAGGAAGCAGTGGGACTCGAAGGCCATCAACGATTTGACTGACTCCTATGGACAGGAATGGACCTACCGTGACCGCAAGGCGCTCGAGTTTACTTGCCACACCGCATTCTTCGTATCTATTGTCGTTGTGCAATGGGCCGACTTGATTATCTGCAAGACCCGCCGTAACTCGATCATTCACCAGGGCATGCGCAACTGGGCCCTCAACTTTGGTCTCATATTTGAAACCGCGCTGGCGGCGTTCCTCTCGTACACTCCCGGTATGGACAAGGGCTTGAGGATGTACCCACTCAAGTTCGTGTGGTGGCTGCCCGCCATTCCGTTCATGCTGTCCATCTTCATCTACGACGAGATCAGGCGCTTCTACCTGCGCCGCAACCCCGGCGGCTGGCTCGAACAAGAGACTTATTATTAA
Protein
MGETRRKPPAKKRKPGDLEDLKQELDIDYHKVTPEELYQRFQTHPENGLSHAKAKENLERDGPNALTPPKQTPEWVKFCKNLFGGFALLLWIGAILCFIAYGIQASTVEEPADDNLYLGIVLAAVVIVTGIFSYYQESKSSKIMESFKNMVPQFATVIREGEKLTLRAEDLVLGDIVEVKFGDRIPADIRIIEARGFKVDNSSLTGESEPQSRGAEFTNENPLETKNLAFFSTNAVEGTAKGIVICCGDNTVMGRIAGLASGLDTGETPIAKEIHHFIHLITGVAVFLGVTFFVIAFILGYHWLDAVIFLIGIIVANVPEGLLATVTVCLTLTAKRMASKNCLVKNLEAVETLGSTSTICSDKTGTLTQNRMTVAHMWFDNQIIEADTTEDQSGVQYDRTSPGFKALAKIASLCNRAEFKGGQDGVPILKKEVAGDASEAALLKCMELALGDVLSIRKRNKKVCEIPFNSTNKYQVSIHESDDPSDPRHLLVMKGAPERILERCSTIFIGGKEKVLDEEMKEAFNNAYLELGGLGERVLGFCDLQLPSDKYPIGYKFNTDDPNFPLDNLRFVGLMSMIDPPRAAVPDAVAKCRSAGIKVIMVTGDHPITAKAIAKSVGIISEGNETVEDIAARLNIPVSEVNPREAKAAVVHGTELRELNSDQLDEILKFHTEIVFARTSPQQKLIIVEGCQRLGAIVAVTGDGVNDSPALKKADIGVAMGIAGSDVSKQAADMILLDDNFASIVTGVEEGRLIFDNLKKSIAYTLTSNIPEISPFLAFILCDIPLPLGTVTILCIDLGTDMVPAISLAYEAPESDIMKRQPRDPYRDNLVNRRLISMAYGQIGMIQAAAGFFVYFVIMAENGFLPMKLFGIRKQWDSKAINDLTDSYGQEWTYRDRKALEFTCHTAFFVSIVVVQWADLIICKTRRNSIIHQGMRNWALNFGLIFETALAAFLSYTPGMDKGLRMYPLKFVWWLPAIPFMLSIFIYDEIRRFYLRRNPGGWLEQETYY

Summary

Description
This is the catalytic component of the active enzyme, which catalyzes the hydrolysis of ATP coupled with the exchange of sodium and potassium ions across the plasma membrane. This action creates the electrochemical gradient of sodium and potassium ions, providing the energy for active transport of various nutrients.
Catalytic Activity
ATP + H2O + K(+)(out) + Na(+)(in) = ADP + H(+) + K(+)(in) + Na(+)(out) + phosphate
Subunit
The sodium/potassium-transporting ATPase is composed of a catalytic alpha subunit, an auxiliary non-catalytic beta subunit and an additional regulatory subunit.
Miscellaneous
Ouabain-sensitive electrogenic ion pump.
Similarity
Belongs to the cation transport ATPase (P-type) (TC 3.A.3) family. Type IIC subfamily.
Keywords
Alternative splicing   ATP-binding   Cell membrane   Complete proteome   Ion transport   Membrane   Nucleotide-binding   Phosphoprotein   Potassium   Potassium transport   Reference proteome   RNA editing   Sodium   Sodium transport   Translocase   Transmembrane   Transmembrane helix   Transport  
Feature
chain  Sodium/potassium-transporting ATPase subunit alpha
splice variant  In isoform 2, isoform 3, isoform 6 and isoform 7.
EC Number
7.2.2.13
EMBL
LC029030    BAS22117.1    JQ771512    AFU25681.1    JQ771498    AFU25667.1    + More
JQ771525    AFU25694.1    NWSH01000562    PCG75638.1    JQ771506    AFU25675.1    JQ771509    AFU25678.1    KZ150095    PZC73617.1    PCG75639.1    PCG75637.1    ODYU01002679    SOQ40480.1    JQ771510    AFU25679.1    JQ771504    AFU25673.1    JQ771508    AFU25677.1    JQ771507    AFU25676.1    JQ771502    AFU25671.1    ADTU01017127    ADTU01017128    AAAB01008859    EAA44868.4    JQ771505    AFU25674.1    AXCN02000326    GFDF01009103    JAV04981.1    QOIP01000014    RLU14937.1    JR035472    JR035478    AEY56435.1    AEY56441.1    APGK01054932    APGK01054933    KB741253    ENN71823.1    KZ288428    PBC25851.1    KB632340    ERL92967.1    GL767232    EFZ13954.1    GL439921    EFN66583.1    EGK96744.1    EGK96743.1    GFDL01000352    JAV34693.1    GFDL01003664    JAV31381.1    GDAI01000902    JAI16701.1    EGK96746.1    KQ980960    KYN11056.1    CH933806    KRG02333.1    GBYB01000331    JAG70098.1    GFDF01009104    JAV04980.1    CH940652    KRF78692.1    S66043    AAB28239.1    GGFK01000592    MBW33913.1    CM000070    EIM52611.1    KY921817    ART29406.1    GGFL01004278    MBW68456.1    GGFL01004964    MBW69142.1    GGFK01000778    MBW34099.1    GGFK01001996    MBW35317.1    GFDF01009105    JAV04979.1    GGFL01004280    MBW68458.1    JQ771524    AFU25693.1    GGFL01001054    MBW65232.1    CP012526    ALC47775.1    CH964232    KRF99409.1    KK107405    EZA51212.1    CM000160    KRK02982.1    GBXI01008719    JAD05573.1    CVRI01000070    CRL07212.1    CH902617    KPU79732.1    GGFK01000581    MBW33902.1    CH477835    EAT35802.1    X14476    AF044974    AE014297    AY069184    AY174097    AY174098    U55767    X17471    GALA01001249    JAA93603.1    KRK02985.1    CRL07214.1    GBXI01010944    JAD03348.1    JQ771500    AFU25669.1    GFDL01003659    JAV31386.1    JR035470    JR035477    AEY56433.1    AEY56440.1    JQ771526    AFU25695.1    KRG02334.1    KRF78687.1    GFDL01003657    JAV31388.1    GFDL01000313    JAV34732.1    JQ771511    AFU25680.1    JQ771523    AFU25692.1    GDHF01020773    JAI31541.1    GAKP01010640    GAKP01010638    JAC48312.1    GFDL01003660    JAV31385.1    GEBQ01003038    JAT36939.1    KRF78691.1   
Pfam
PF00690   Cation_ATPase_N        + More
PF00689   Cation_ATPase_C
Interpro
IPR018303   ATPase_P-typ_P_site        + More
IPR004014   ATPase_P-typ_cation-transptr_N       
IPR023299   ATPase_P-typ_cyto_dom_N       
IPR006068   ATPase_P-typ_cation-transptr_C       
IPR008250   ATPase_P-typ_transduc_dom_A_sf       
IPR023298   ATPase_P-typ_TM_dom_sf       
IPR005775   P-type_ATPase_IIC       
IPR001757   P_typ_ATPase       
IPR023214   HAD_sf       
IPR036412   HAD-like_sf       
SUPFAM
SSF81665   SSF81665        + More
SSF81660   SSF81660       
SSF81653   SSF81653       
SSF56784   SSF56784       
Gene 3D
PDB
3WGV     E-value=0,     Score=3968

Ontologies

Topology

Subcellular location
Membrane  
Cell membrane  
Length:
1009
Number of predicted TMHs:
8
Exp number of AAs in TMHs:
172.12338
Exp number, first 60 AAs:
0
Total prob of N-in:
0.99690
inside
1  -  80
TMhelix
81  -  103
outside
104  -  115
TMhelix
116  -  135
inside
136  -  275
TMhelix
276  -  298
outside
299  -  307
TMhelix
308  -  330
inside
331  -  835
TMhelix
836  -  858
outside
859  -  898
TMhelix
899  -  918
inside
919  -  937
TMhelix
938  -  960
outside
961  -  969
TMhelix
970  -  987
inside
988  -  1009
 
 

Population Genetic Test Statistics

Pi
241.608966
Theta
198.924669
Tajima's D
0.794025
CLR
0.392542
CSRT
0.604669766511674
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
31250652 LPLPAVEDTMNRVGFNAEHSW 100.00 4e-07
26822097 EVAGDASEAAIIK 100.00 2e-04
26822097 SVGIISEGNETVEDIAAR 100.00 2e-04
25044914 GIVGTIIER 100.00 2e-04
28467696 GIVHQVDYWGEGK 100.00 2e-04
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号