SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15311
Annotation
endonuclease-reverse_transcriptase_[Blattella_germanica]
Location in the cell
Mitochondrial   Reliability : 3.127
 

Sequence

CDS
ATGAGGCTTAAGAACAACAAAGCGCCAGGTATTGACAACCTACCATCTGAACTGTGGAAATACGGCGGAGAAGCCTTGCAGTCCAGATTCTACAATCTTATTAAAATGATATGGGAATCTGAACAACAACCTGTCCAGTGGTATTCGGGGGTCATCTGCCCCATACACAAAAAAGGCAGCCGGAAGAAATGCAGTAACTACAGAGGAATTGCTTTACTACCTACAGCGTACAAAATACTGTCATACGTTTTACTAAGCAGGTTAGAGCCGTATTCAGACAAAATCATTGGGGATTATCAGTGCGGCTTCAGACGTAATCGTAGTACAGTCGACCAAATCTTTACTCTGAAACAGTTAATGGAGAAAAGATGGGAGTATGCACAAAGTATTCATTCGCTCTTTGTTGATTTTGCTAAGGCCTACGACAGCATAGATAGACCGACTCTATATAGAATCCTCACGCGCTTTAAAATCCCACAGAAACTTGTGAGAATGGTGGAGGTTGCTACTATGGAAAGTAGAATGACGGTACAAGTTGGCGCTTCTCTCACTGATGAGTTTGACGTTGTGACTGGACTCAGGCAGGGGGACGCTCTGTCACCAATGCTGTTCAACCTGGCACTGGAACACGCCATACGGAAAGTGAACACACTTAGTGGCGGAGTGTGGCTCAACGGACAGCATAGGGTGATAGGATATGCCGATGACCTCACTCTACTTGGAGGAAGAAAGCAGCACGTTATAGACGCACTCAACTGCCTCCAACAAGAAGCTTCTCGGATTGGCCTTCGCGTGAGCCACGAGAAGACAGAATATCTTCACATGCGTCGATATAAAAACGTAAGACGGAAGCGAGAAGACCTAGTGGTGGGAAATACGAGGTTCAAAGGAGTGGCTAAATTCCGGTACCTTGGCTGCACTGTAACAGACACCAATGACAGGGAAGATGAAATCGAAATTCGTATACAAAATACCCTACGATGCAGTGCAGCCCTACACCCGGTTCTCTCTTCGAAGCTACTAAGCAGGCGCACCAAGATTCGGATATACAAGACTCTAGTCAGACCGATCCTATTGTATGGATGCGAAGCATGGACGCTCACACAGAAAGAAGAGGCAAAACTTCTCGTGACGGAGCGAAAGGTATTGAGAAAAATACTAGGACCAGTTCGGAAAGAAGACGGTTCTTGGCACGTCCGGAAAAATAAGGATGTGGAGAGGCTTTTTGGTGAGCCAAATATTCTGGGGGAGATGAAGGCACGGAGGCTCGGATGGCTCGAACATGTAGTACGTATGGAGCAGGATCGGGCTGTGAAACGGGTGTACACGGGTGTACCGGAGGGACGCCGCCCCGTAGGGAGGCCCAAGTACCGCTGGTGTGACGCTGTGGAAGGAGATTTACGGGAGCTCCAAGTGTCGGACTGGTAA
Protein
MRLKNNKAPGIDNLPSELWKYGGEALQSRFYNLIKMIWESEQQPVQWYSGVICPIHKKGSRKKCSNYRGIALLPTAYKILSYVLLSRLEPYSDKIIGDYQCGFRRNRSTVDQIFTLKQLMEKRWEYAQSIHSLFVDFAKAYDSIDRPTLYRILTRFKIPQKLVRMVEVATMESRMTVQVGASLTDEFDVVTGLRQGDALSPMLFNLALEHAIRKVNTLSGGVWLNGQHRVIGYADDLTLLGGRKQHVIDALNCLQQEASRIGLRVSHEKTEYLHMRRYKNVRRKREDLVVGNTRFKGVAKFRYLGCTVTDTNDREDEIEIRIQNTLRCSAALHPVLSSKLLSRRTKIRIYKTLVRPILLYGCEAWTLTQKEEAKLLVTERKVLRKILGPVRKEDGSWHVRKNKDVERLFGEPNILGEMKARRLGWLEHVVRMEQDRAVKRVYTGVPEGRRPVGRPKYRWCDAVEGDLRELQVSDW

Summary

EMBL
PYGN01000510    PSN45119.1    PYGN01000451    PSN46127.1    PYGN01000064    PSN55609.1    + More
PYGN01000502    PSN45243.1    PYGN01001382    PSN35227.1    HE799691    CCH14900.1    PYGN01000047    PSN56294.1    PYGN01000203    PSN51319.1    PYGN01000020    PSN57453.1    PYGN01000070    PSN55417.1    PYGN01000324    PSN48495.1    PYGN01000219    PSN50892.1    AJVK01001578    PYGN01001004    PSN38555.1    PYGN01001494    PSN34463.1    GBBI01004263    JAC14449.1    PYGN01000613    PSN43351.1    PYGN01000629    PSN43121.1    GDAI01000742    JAI16861.1    PYGN01000287    PSN49259.1    GGFK01003183    MBW36504.1    GGMR01000126    MBY12745.1    GGMR01016675    MBY29294.1    FJ265555    ADI61823.1    GGMR01014652    MBY27271.1    PYGN01000082    PSN54842.1    LBMM01005351    KMQ91586.1    PYGN01000119    PSN53667.1    PYGN01000580    PSN43876.1    QOUI01000020    RCK67885.1    PYGN01000107    PSN54137.1    GGFK01002192    MBW35513.1    GGFK01002196    MBW35517.1    GGMR01006433    MBY19052.1    GBBI01004198    JAC14514.1    GDHC01021627    JAP97001.1    GBRD01000202    JAG65619.1    NEVH01019065    PNF23216.1    PYGN01003402    PSN29545.1    PYGN01000078    PSN55011.1    ABLF02027703    ABLF02061609    KU311054    ALX81665.1    GGFK01001949    MBW35270.1    GGFL01003846    MBW68024.1    GGFK01005184    MBW38505.1    ABLF02066124    GGFK01001798    MBW35119.1    GBRD01017846    JAG47981.1    GGFK01003613    MBW36934.1    QOIP01000009    RLU18885.1    GGFL01003845    MBW68023.1    PYGN01000372    PSN47498.1    GBBI01004261    JAC14451.1    GGMR01010991    MBY23610.1    GBGD01000331    JAC88558.1    ABLF02026145    ABLF02026146    ABLF02042729    GBBI01004199    JAC14513.1    GGMR01000301    MBY12920.1    GGMR01020071    MBY32690.1    GGMR01011466    MBY24085.1    IAAA01017079    LAA06070.1    PYGN01000254    PSN50032.1    ABLF02036907    ABLF02036915    ABLF02036922    ABLF02041419    CH902619    KPU76535.1    ABLF02039015    GECL01002632    JAP03492.1    CH902653    KPU74858.1    ABLF02009557    ABLF02016497    ABLF02041313    ABLF02041567    ABLF02062088    GECL01001585    JAP04539.1    GBRD01011073    JAG54751.1    ABLF02003877    ABLF02042991    ABLF02018097    ABLF02043469    ABLF02056908    CH902621    KPU81727.1    PYGN01001465    PSN34679.1    CH902657    KPU75308.1    CH902626    KPU79149.1    CH904714    KPU81814.1    GGMR01001794    MBY14413.1    PYGN01000212    PSN51056.1    ABLF02019047    ABLF02019049    GBBI01004262    JAC14450.1    GECU01011157    JAS96549.1    ABLF02033384    ABLF02020712    ABLF02020717    ABLF02054820    ABLF02010115    ABLF02030763    GGFJ01005240    MBW54381.1    ABLF02067155    GALA01001775    JAA93077.1    CH902961    KPU72636.1    GBHO01037470    JAG06134.1    ABLF02013530    ABLF02013531    ABLF02013532    ABLF02043861    ABLF02057183    ABLF02067179    GAPW01000107    JAC13491.1    ABLF02005950    ABLF02005951    AZNE01000717    KID80942.1    GAPW01000199    JAC13399.1    PYGN01000577    PSN43959.1    CH905131    KPU81852.1    ABLF02020512    ABLF02020516    ABLF02046511    CH902714    KPU81861.1    GBHO01037471    GBRD01009355    GBRD01009354    GDHC01014856    GDHC01007898    JAG06133.1    JAG56469.1    JAQ03773.1    JAQ10731.1   
Pfam
PF00078   RVT_1        + More
PF03372   Exo_endo_phos
PF14529   Exo_endo_phos_2
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000637   HMGI/Y_DNA-bd_CS       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
475
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.96264
Exp number, first 60 AAs:
0
Total prob of N-in:
0.19720
outside
1  -  475
 
 

Population Genetic Test Statistics

Pi
151.242966
Theta
124.148198
Tajima's D
1.22253
CLR
0.16995
CSRT
0.720613969301535
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号