SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15269
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 1.544
 

Sequence

CDS
ATGCGCTCTGCGCTCGCCAGTGATTCGGGTGCGATCATCCCCACCAAACCATCGGCGGAGAAAAAGAGGGGCCGAAGGAAGACCCCCGTAGTATCTTCCGACGACGGCGGTGCGTCATCCTCCAGCACTGAGGTGCCGGAAAAGACCATGGCCATCGAGGACGTGGCTCCGGTGATTTCGGGGCCTGCCGCGTCGAAAGACACGATGCCCGCACCCCAGCGGGCACCAGTAAGGAGGAGGGGTGCCGTTTCACCGGCGACATCGGTGGAGTCGATGTCGACGTCGGTTGCGTCTATGGCTAGCGGGGACGAGACGTTTCGTGATCTCGACCTCGCGCTGGTCAATCTCGGTAAACTGCTGTCAACCGTGGCTGCCAAGGGCGCCCAACCAGGCAGCAGCTACCGGAAAAGGCTTCGGGAGGGAGCCGCTATGGTAAGGACGAGACTGATCCCCACCATGTCCAAGCTCTATGACTTGGTGGCGAGCCGGGAGGCTGAAAACAAAGGCCTCGTCGCACAGCTTGACTCCAGGGAGAGTCGCATCCCGGGGGACTCCTCGGCCTCGCGGGGAGAGACTTCCCTGTCGCCAGTGCCTACGCTGGCATGCTCTGGGCCCTCCGTGGGGACGATGGACACTAACGTGCCCTCGCAGGCTGCGATGAGTGTGGCGGCGCCTATGACAGCGCCCATCCCTGTGGCCCCTGTGACGCGAGCACTCACTCCTGTGCTCCCCCGATCCCCACGGAGAGTTGAGTTAAGGCCTGCGCCGCCTCCGTCGATACCGGCTGCCTCTGCATCCACACGGAGAGGAAGGGTAAGGCCTGCGCCAGCGCAGGCTGGCGACATCCGTTCGCCACTTGCGAAGATGGTGGACGAGTGGCCGGCGCTGCCACGGCCTAGGATTGCGGAGCCGCCTCTTTCGGCCCCGCGTGCTGCGGGGTCGCAGAGGCCAAACAATATGGCTGCTGGGATGGGGGGGGTGGATGACTGCCTCCCAAGCAGAGAGGAAATTGTGGCCTGCATCTCGCGGGCGGTGGCGGTTGAGGTCGGCAAGCACTTTGCCGGCCTCGAGGAGATGCTCCGCTCCTCAATTCGTTCCGGAGACTGCATCCCGGTGCCAACAGTCGCGGTCAGTCCGCGGGATCGGGCCGCCCGGCCGACCTCCGCTCCTACCCCACCTGCGAGAGTGGTTCGGCGTGGAGGCCGGAACCAGAACAACAGAGGTGTCAGGGACCAGAATCCCGCCCCACGTTCCCAACCACAGCCTCGTCCCCTTCCGCCTCCCCCATCAAGCATGGACGAGGGCTGGACGGAAGTGGTGAGGCGGGGCACCCAGGCATGGCGACAGACAGCGGCTCTGGCAGCTCCCCGGGGGGGTCGAGCGCCGACCGCTACAGCCCGTAAAACAGCGCTAGCGGCCGTGGCTGCTCCCCGTGAGGGTCGAGCACCGGCCGCTGGCAAGAAGAAAAGCAAGAAGAAGAAGCCGCGTGCAGCGCGGTCGGCTGCCGTTGTAGTGACATTGCTGCCGGCCGCCGCCGAAAAGGGCCTTACCTATAATAATGTGATGGCCCGGGCGCGCGCGGCTGTAAATTTGAAAGAAATCGGGGCAGAAGAAGGCCTCCGTTTCCGGCAGACTGCCAATGGGGCGAAGCTGCTGGAGTGTCCCGGTGCCGACAGCTCTGGCATCGCAGAAAAACTAGTGGCGACGCTCCGCGTGGCGCTGCCGGAGGAAGAGGTGCGCGTGCACAGGCCGGTGAGGATGGCCGAGATTAGGATCACCGGCCTGGACGACTGCGCCACCAAAGAGGAGGTGGCAGCCGCGATAGCCGCCCAGGGTGGATGTGCTCCAGAGAGTGTGACCGTGGGTGAACTCCGCTCAGGGTACTCCGGGGCCAGGGCGGCGTGGGCGTGCTGTCCGGTTGAGGCGGCTACCTTATTGGCCACTCCTCCACCGGGAAGATCGACGGGGGATCCAGGGAGACTGCGAGTGGGCTGGATAGCGGCCCACGTGCGTCTTCAAGAACCGCGGGCCTGGAGATGCCTGCGGTGCTTTAGCACTGGACACGGCCTCACCAGGTGCACCAGCTCGGTTGACCGCAGTGGTCTCTGCTTCCGATGCGGCCAACCGGGTCATAAAGCGGCGTCCTGCACGGCCGCCCCGCACTGCGCTCTGTGCGCTACAGCCGGGCGCGGGGCAAACCATCGGGCAGGAGGCAAAGCGTGCTTCCCGTCCGGTGATGATACCGAACGCAACCGGCGTCGCAAGGCAAAGCGCCGGCAGAAGAGAAAGTTGGCCAGAGGAGCACTGGCCAACGTTGTAATCCCCGCTGCGGCGCCGGTGCCGGAGGGCGGGGGCAGCGGAAACCTGAATAACTCCGCCAGAGCTCAGGACATGCTGTCTCAGAGCATGGCGGAGTGGTCCATAGATGTGGCTGTGGTCGCCGAGCCGTACTTCGTTCCCCCGGCAAATGATTGCTGGTTCGGGGACGATGACGGCCTGGCGGCCATAGTCATAAGAAGAGACGCGGCGATCCCCCCCCTGGCGATGGTGACCAGGGGCCAAGGGTTCGTCGCGGTGCAGTTGGAAGGGACCGTCGTGATCGGGGCGTACTTCTCTCCGAACAGGCCTACTGTCGAGTTCGGGCATTTCCTGGGCGGGATCGGGGCGATTGCTCGCCGCCTTGCTCCCCGCTCAGTGATTCTCGCGGGGGACCTCAATGCGAAGTCTGTCGCATGGGGCTCCCCCCGCTCGGACGCTCGTGGTAGGCTACTGGAGAGGTGGGCGAACGCGGCCGGCCTCTGTTTGTTGAATAGAGGTTCGGTTGCGACGTGCGTGCGGTGGCAGGGCGAGTCTATTGTGGACGTTACATTCGCAAGCCCGGCCATCGCACGCCGTATCCGCGACTGGAGAGTTTTGGAGGGGGCGGAGACACTGTCAGATCACCGATATATTCGGTTTGATCTCTCCGCCCGCTCCGCAGTCGCGGACGTCCACGGGGACCACCCCCGTGGTGCGTCCCGGTCATTCCCCAAGTGGGCACTGAAGCGCCTGAATAAGGAGCTCCTGATGGAAGCCTCTACGGTGGCGGCGTGGGCGCCCATGCGTCCACACCCGGTCGAGGTCGAGGGAGAGGCAGGGTGGTTCCGGGACACGATGCGTCGCATCTGTGATGCGTCGATGCCCCGGATCGGCCCTCGACTTCCTAATCGCCAGGCGTACTGGTGGTCGCCCGAAATTGCGCAACTCCGCGTGGAGTGCGTTCGGGCGAGGCGCGAGTGCGCCAGGCATCGCCACCGCTGCCTGCCGCGGCGCAACGATCCGGTTGCGTTCGCGGCGGCAGAGGCCCGGCTGCACGGTGCATTTCGCGTCGCGCAGAGGGCATTGCAGCTGGCCATCAGAAGAGCCAAGAACCAACACATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAAGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGAATACGACGGCGAAGTCCCTGCTGAGGTGCTCCGCATAACGGGGGCGGAGCTCCGTGTGGCCGTGCGCAAAATGTGCGCGAAAGACACTGCACCCGGCCCGGATGGCATCCATGGCCGGGTTTGGGCCTTGGCTCTTAGTGCCCTAGGGGACCGACTCTTGAGGCTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAAGGGCGCCCGGCGGATACTGCCGCTGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCGGCCCGCATCATTCAGCATCTGGTCAGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGCTTCCGAGAGGGCCGCTCAACAGTAGACGCGATCCTTCGCGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGACATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGGGGGGGCGCTGGAACGACATGGAGTGCCTCCCTACCTCCGCCGGCTGGTGGGTTCCTACTTGGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGACGACACGTTAGTCGTGGCCCGGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACCGCTGGGGTGGCGCATGTCGTCGGCAAAATCAGGAGATTGGGCCTCGACGTGGCGCTCAGTAAATCCGAGGCCATGTGGTTCCACAGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTCGGCCTCATCCTGGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCTGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCACCTGTGTGGGGCCAGTCCCTGGCCGCGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGATTCTGGAAGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCTGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCCGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAATTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCGGAGCACACGCTCGTTGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAACAGGAAACGACTTGTCGTTGCCGAGTGTCGTGGCATCGATGCTCGGCGACGGCGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MRSALASDSGAIIPTKPSAEKKRGRRKTPVVSSDDGGASSSSTEVPEKTMAIEDVAPVISGPAASKDTMPAPQRAPVRRRGAVSPATSVESMSTSVASMASGDETFRDLDLALVNLGKLLSTVAAKGAQPGSSYRKRLREGAAMVRTRLIPTMSKLYDLVASREAENKGLVAQLDSRESRIPGDSSASRGETSLSPVPTLACSGPSVGTMDTNVPSQAAMSVAAPMTAPIPVAPVTRALTPVLPRSPRRVELRPAPPPSIPAASASTRRGRVRPAPAQAGDIRSPLAKMVDEWPALPRPRIAEPPLSAPRAAGSQRPNNMAAGMGGVDDCLPSREEIVACISRAVAVEVGKHFAGLEEMLRSSIRSGDCIPVPTVAVSPRDRAARPTSAPTPPARVVRRGGRNQNNRGVRDQNPAPRSQPQPRPLPPPPSSMDEGWTEVVRRGTQAWRQTAALAAPRGGRAPTATARKTALAAVAAPREGRAPAAGKKKSKKKKPRAARSAAVVVTLLPAAAEKGLTYNNVMARARAAVNLKEIGAEEGLRFRQTANGAKLLECPGADSSGIAEKLVATLRVALPEEEVRVHRPVRMAEIRITGLDDCATKEEVAAAIAAQGGCAPESVTVGELRSGYSGARAAWACCPVEAATLLATPPPGRSTGDPGRLRVGWIAAHVRLQEPRAWRCLRCFSTGHGLTRCTSSVDRSGLCFRCGQPGHKAASCTAAPHCALCATAGRGANHRAGGKACFPSGDDTERNRRRKAKRRQKRKLARGALANVVIPAAAPVPEGGGSGNLNNSARAQDMLSQSMAEWSIDVAVVAEPYFVPPANDCWFGDDDGLAAIVIRRDAAIPPLAMVTRGQGFVAVQLEGTVVIGAYFSPNRPTVEFGHFLGGIGAIARRLAPRSVILAGDLNAKSVAWGSPRSDARGRLLERWANAAGLCLLNRGSVATCVRWQGESIVDVTFASPAIARRIRDWRVLEGAETLSDHRYIRFDLSARSAVADVHGDHPRGASRSFPKWALKRLNKELLMEASTVAAWAPMRPHPVEVEGEAGWFRDTMRRICDASMPRIGPRLPNRQAYWWSPEIAQLRVECVRARRECARHRHRCLPRRNDPVAFAAAEARLHGAFRVAQRALQLAIRRAKNQHMEGLLETLDEDPWGRPYHMPQQLRDIVSALFPQEREGFVAPAMDAPPEYDGEVPAEVLRITGAELRVAVRKMCAKDTAPGPDGIHGRVWALALSALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVRVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVGGRWNDMECLPTSAGWWVPTWRTDRSRVPDTVGSCTGSRSCAVFHRDDTLVVARGGSFAESARLATAGVAHVVGKIRRLGLDVALSKSEAMWFHRPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAAGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWILEAEALAADYQWRADLRARGVARPSPCVVRARRAQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKTGNDLSLPSVVASMLGDGESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
Interpro
IPR001878   Znf_CCHC        + More
IPR036875   Znf_CCHC_sf       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
PDB
1WDU     E-value=3.66931e-11,     Score=170

Ontologies

Topology

Length:
1788
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.10757
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00027
outside
1  -  1788
 
 

Population Genetic Test Statistics

Pi
147.825673
Theta
133.45711
Tajima's D
0.026416
CLR
0
CSRT
0.382230888455577
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号