SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15265
Pre Gene Modal
BGIBMGA005029
Annotation
PREDICTED:_nephrin-like_isoform_X1_[Bombyx_mori]
Location in the cell
Extracellular   Reliability : 1.279 PlasmaMembrane   Reliability : 1.339
 

Sequence

CDS
ATGAATTACGACATAGTATTACGATTGTCTACGGTCGATGTGGATGCAGTCCTAGGGCGCACTGCGTCCTTGCCCTGTGACGTCACGCCCGACGCCAACGAAGACCGCGTGTACATGGTGCTCTGGTTCAGGAAAAGTGGAGGGAAACCTATATACAGCTTTGACGTACGGGGGCGTTCATTCAACAAAGCTCTACAATGGTCGGACCCTGGCGCTTTCGGACCACGAGCTTACTTCGCAACTGTCGCTCGACCGGCGGCCCTGACCTTGACCTCCGTGCAACTTGACGACGAAGGCGTATACCGATGCAGAGTAGACTTCAAGAATTCACCCACAAGAAATTTTCAAATACGGCTGACTGTTATCGTGCCTCCTCATCAAATGTTATTATATGACAAGTCAGGAGCTGATGTGTCTGGAGTCGTAGGACCTTTGGAAGAAGGTGCAGCATTAGTTCTGATCTGCGAAGTACGCGGAGGTCGTCCAGAGCCGCTTGTTTCTTGGTGGATAAACGGCGTACCGGCTCCTCAATACATTGGTATCAAAACCGATACCCACGTGGTGGTGAACAGGCTCGAACACCAAAATTTGAAACGAGATGATCTGAACACGACCTTCAAATGTAGAGCTACAAATACTAATTTGGTTCCACCCCAAGAGAAAGTTGTAAGGCTGGAGTTGAATCTGTCTCCGCTTTCCGTTTCTTTGCTGAACCGACCGCAGCAGTTGTTAGCCGGCTCAGCTGCGACCATACGATGCGTATCCGAAGGCAGCCGACCTCCAGCACAGATCTCATGGTTTAAAGACAACAGGAGTTTTTCAAAAAACATGATATCGGATCACTCAAATGAAACGTGGTCACTCAGTGCGTTAGTGTTCACTCCAGCGCCTACGGATCACGGAACTACAATCAAATGCGTCGCAGCGAACCCTAGCCTACCTACTAAGACTATTAACGATCAGCTACTGCTTAATGTTGTATATAGTCCCCTGGTGATCCTGACTTTGGGCAGCACTCTCAACCCAGACGACATCAAAGAAGGGGACGACGTTTACTTCGAGTGCAATGTCCGAGCGAATCCTCGGGAGCATCGAATATCATGGTACCACAATGACAGGCCGGTGATGCAGAATATGTCTTCGGGTATCATCGTGAGTACGCGGTCTCTGGTTCTGCAGAAGGTTACGAGAGGAGAAGCCGGCGCCTATACTTGCAAAGCGGCTAATTCTCGAGGCGAAACTTCTAGTCAAGCTGTGAAATTGAGAGTGCAATATGCTCCGGTTTGCTCTGAACCATCTCCTCAAGTAGTAGGGGCCGCAATAGATGAGGCTTTACAAGTTCGATGCGCGGTCCACGCGGACCCTTCAGACGTAACTTTCTTATGGCAATTCAACAATAGCGGAGAGAGTTTCGACGTTTCTCCAGCTAGATATGGTACAATCAACAGCAGTGTAAGTGAGCTTCGGTACAGGCCATCAAGTGAAAGGGATTATGGAGCTCTAACATGCAGTGGTATTAACACAGTAGGTCGGCAAACACAGCCCTGCGTTTTCCAAATTGTTCCAGCTGCTCGCCCCTCACCTCCAAAGAATTGCACAGTAACGTCTAGTAACAATTCGACTTGGCTGGAAGACTCCAAAGAAGAAACGGAAGATTTTCTGATTGTGCGATGTGTGACCGGCTATGACGGCGGTCTTCCACAACTGGTTGTACTGGAAGCAGTTGATTCTGACAGTGGAACTGTTAGATTCAATGTAACTGCCAATGAAACAGATGGAGTTGCCTTCTTCTCGGTGCCTTCAGGAGTTTTGTGGTCGAGTAGAAATGCTTTAAGACTCACCGTACATTCTAGGAACGATAAAGGATCCTCTGAACGTATTTTGCTTCAAGCACTCACTTACCAAGGACCGGAAAGGAGAACAGATGGAGTCAATAACTTAGTAGCCGGAGTATCTAAAACTGCGTTTTGGGCCATAATTGTTACATCTGTGATCACCGCCAGCGCACTGATACTCATCGTGTATTTTTTGAGAAGAAAGAGGGAGAGACCGACAATGAAACAATCATCAGAGCTTCAAATCAACGCTGGATCCGGTCAGTATGTGGTAGCGTACACACTAAAACCTTCTAAACAAGCTCAACCTGATATCTTAAATCCACCTTCTGATGGGGGCACTCAAATTGCTAAGGGCGTTGCAGGGACTGTCAAAAATGGCACTCTACCCATGAGTGACGAGTGGTCCGCCGGCGAAAGAGCCCAGTACGCGTCGTCGCCGAAAACGTCACTCTCAAGTAAGCCAGCTGCCTCTGGGACCACCACGCTCAGTAGGAGAGAGCATCTCATAGCTGAAGAGATCCCAGGACCGGAGAGTTGCGTATAA
Protein
MNYDIVLRLSTVDVDAVLGRTASLPCDVTPDANEDRVYMVLWFRKSGGKPIYSFDVRGRSFNKALQWSDPGAFGPRAYFATVARPAALTLTSVQLDDEGVYRCRVDFKNSPTRNFQIRLTVIVPPHQMLLYDKSGADVSGVVGPLEEGAALVLICEVRGGRPEPLVSWWINGVPAPQYIGIKTDTHVVVNRLEHQNLKRDDLNTTFKCRATNTNLVPPQEKVVRLELNLSPLSVSLLNRPQQLLAGSAATIRCVSEGSRPPAQISWFKDNRSFSKNMISDHSNETWSLSALVFTPAPTDHGTTIKCVAANPSLPTKTINDQLLLNVVYSPLVILTLGSTLNPDDIKEGDDVYFECNVRANPREHRISWYHNDRPVMQNMSSGIIVSTRSLVLQKVTRGEAGAYTCKAANSRGETSSQAVKLRVQYAPVCSEPSPQVVGAAIDEALQVRCAVHADPSDVTFLWQFNNSGESFDVSPARYGTINSSVSELRYRPSSERDYGALTCSGINTVGRQTQPCVFQIVPAARPSPPKNCTVTSSNNSTWLEDSKEETEDFLIVRCVTGYDGGLPQLVVLEAVDSDSGTVRFNVTANETDGVAFFSVPSGVLWSSRNALRLTVHSRNDKGSSERILLQALTYQGPERRTDGVNNLVAGVSKTAFWAIIVTSVITASALILIVYFLRRKRERPTMKQSSELQINAGSGQYVVAYTLKPSKQAQPDILNPPSDGGTQIAKGVAGTVKNGTLPMSDEWSAGERAQYASSPKTSLSSKPAASGTTTLSRREHLIAEEIPGPESCV

Summary

EMBL
RSAL01000001    RVE55340.1    ODYU01000599    SOQ35673.1    KQ460045    KPJ18125.1    + More
AGBW02008103    OWR54162.1    KQ459604    KPI92377.1    NWSH01001251    PCG71977.1    KPJ18124.1    KZ149994    PZC75507.1    JTDY01000670    KOB76275.1    AGBW02009972    OWR49444.1    RSAL01000082    RVE48510.1    KQ434905    KZC11236.1    ACPB03001712    QOIP01000012    RLU15688.1    GL449385    EFN82816.1    KZ288194    PBC33881.1    KQ976488    KYM83604.1    KK107185    EZA55761.1    KQ978957    KYN26989.1    GL888128    EGI66806.1    KQ978205    KYM96491.1    KQ981897    KYN33674.1    GL440425    EFN65915.1    KQ982320    KYQ57806.1    ADTU01025477    ADTU01025478    ADTU01025479    ADTU01025480    NNAY01001084    OXU25200.1    AE014297    ABI31143.1    NWSH01000305    PCG77591.1    KZ150231    PZC71994.1    KQ414667    KOC64681.1    GBYB01013606    GBYB01013607    JAG83373.1    JAG83374.1    KQ435863    KOX70423.1    KQ971354    EFA06826.2    GECZ01013250    JAS56519.1    GBRD01006221    JAG59600.1    GBHO01002348    GDHC01008300    JAG41256.1    JAQ10329.1    GEBQ01019020    JAT20957.1    UFQT01000721    SSX26760.1    KK852551    KDR21492.1    JRES01001160    KNC24967.1    GEZM01002471    JAV97235.1    GEDC01028050    JAS09248.1    CH940652    KRF78738.1    CH916369    EDV92962.1    EDW59180.1    KRF78739.1    KRF78740.1    KYB26230.1    CP012526    ALC47181.1    CH933806    EDW14590.1    KRG01093.1    KRG01094.1    CH902617    EDV41691.1    KPU79296.1    KPU79297.1    KPU79299.1    ODYU01008707    SOQ52514.1    NEVH01020344    PNF21422.1    GAKP01006691    JAC52261.1    BT071799    ACN43735.2    CH964272    EDW84074.1    GAMC01011313    JAB95242.1    CM000070    KRT00496.1    OUUW01000013    SPP87858.1    CH479179    EDW24155.1    EAL28149.2    KRT00494.1    KRT00495.1    KRT00497.1   
Pfam
PF07686   V-set        + More
PF08205   C2-set_2
PF00047   ig
PF07679   I-set
Interpro
IPR013106   Ig_V-set        + More
IPR003598   Ig_sub2       
IPR036179   Ig-like_dom_sf       
IPR007110   Ig-like_dom       
IPR003599   Ig_sub       
IPR013162   CD80_C2-set       
IPR013783   Ig-like_fold       
IPR013151   Immunoglobulin       
IPR003961   FN3_dom       
IPR036116   FN3_sf       
IPR013098   Ig_I-set       
SUPFAM
SSF48726   SSF48726        + More
SSF49265   SSF49265       
Gene 3D
PDB
5ZO2     E-value=8.20237e-14,     Score=190

Ontologies

Topology

Length:
793
Number of predicted TMHs:
1
Exp number of AAs in TMHs:
22.89428
Exp number, first 60 AAs:
0.0002
Total prob of N-in:
0.00060
outside
1  -  654
TMhelix
655  -  677
inside
678  -  793
 
 

Population Genetic Test Statistics

Pi
246.134084
Theta
172.33702
Tajima's D
1.427316
CLR
0.525052
CSRT
0.777511124443778
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号