SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15254
Annotation
Transposon_Ty3-I_Gag-Pol_polyprotein_[Operophtera_brumata]
Location in the cell
Cytoplasmic   Reliability : 2.376
 

Sequence

CDS
ATGGATTTACCTATCTTACAAGAGCTTCTGAAGGCCATCAAAGACGCAGTTTCCGGTTCCCGCCAGAACGACAGCGAGGTCGCCCTGCCCGTATTTGATCCTGCTAAAAGTGACCTTGGTGCTGAATCATGGTGCAACAATATTGAAACCCTCTCCAAAGAGTTTGGATGGAGTAACATCGCAACAGTCGCCAAAGCTGGTAAGGCCCTTAAGGGATCCGCCTTATTGTGGTTTGAAACATGGGACCCGCCTGAGGGTCGTTCGTGGGACAATTTACGTTTAGAGCTGGTAGCTTTATACCCTGAGAAAAAGAATCTAGCAGAAAAACTTCATAAGGCAGTGCTATACACGTCGGAAACTGCAGATTCTTATTGCGAGTACGCAAGGGAAAAAATTAGTATAATGGAACTCTCAGGTGCGATAAACAGTCTAGATCATCAGCTGCAGGATAGGATAAGGGCTATTTTTCAAAAATACCCCTCTGTTTTGGACAATATTGGTCATGTAAAGACTGGTGAACTTGAAATAAAATTAAAAAGAGATGAGGTTGAGCGTTATGTGGCTACTGTAGTCAATATGTTAAACACTATGTGCGAGGAGCCGTCAGAGTGGCCGAACGTATTGCCAAAAGTACAGCAGTCAATTAACACGACAGTACAAAAATCGACTGGTTTCACCCCCTTACGTTTACTAACCGGTATAGAAGCAAATATACCTATAGTACAATCTCATCTAAACGGAATTATTAATGATGAGGATTTACACCCCAATATTGACGTCCAAGCTGATCGTGAAATAGCCAAACAGAGACTACAAAAAATAGCAGAAACATTTAAACAACGATTTGATCATGTTAGGCGGAATAATAAACAATACAATATAGGTGATTTGGTCTATGTCAGCCAAGATCATAGGCGTAATGATAAATTAAGATCTAGATTTAAGGGCCCTTACGAAATTCAGTCTATCCTTCCAAATGATCGCTATACTCTGAAAGGCAACGGTAATGTTAGGAATATAGTTGTCGCTAAGGAAAAATTACGGTTTTGGCCAGGAGAATGGGTTGATGATAATTTGTGA
Protein
MDLPILQELLKAIKDAVSGSRQNDSEVALPVFDPAKSDLGAESWCNNIETLSKEFGWSNIATVAKAGKALKGSALLWFETWDPPEGRSWDNLRLELVALYPEKKNLAEKLHKAVLYTSETADSYCEYAREKISIMELSGAINSLDHQLQDRIRAIFQKYPSVLDNIGHVKTGELEIKLKRDEVERYVATVVNMLNTMCEEPSEWPNVLPKVQQSINTTVQKSTGFTPLRLLTGIEANIPIVQSHLNGIINDEDLHPNIDVQADREIAKQRLQKIAETFKQRFDHVRRNNKQYNIGDLVYVSQDHRRNDKLRSRFKGPYEIQSILPNDRYTLKGNGNVRNIVVAKEKLRFWPGEWVDDNL

Summary

Pfam
PF17921   Integrase_H2C2        + More
PF00665   rve
Interpro
IPR041588   Integrase_H2C2        + More
IPR036397   RNaseH_sf       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
SUPFAM
SSF53098   SSF53098       
Gene 3D
ProteinModelPortal
PDB
3DLR     E-value=0.00179707,     Score=97

Ontologies

Topology

Length:
359
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00095
outside
1  -  359
 
 

Population Genetic Test Statistics

Pi
26.197161
Theta
189.043507
Tajima's D
0.149329
CLR
327.741013
CSRT
0.413829308534573
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号