SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15245
Pre Gene Modal
BGIBMGA013783
Annotation
PREDICTED:_RNA-directed_DNA_polymerase_from_mobile_element_jockey-like_[Plutella_xylostella]
Location in the cell
Mitochondrial   Reliability : 3.8
 

Sequence

CDS
ATGCTGAAAAATTTGAATATAACCAAAATATTCGTTTATCGTACCATCAAACGATACAATGAAGACTCTAGTGTAGATGACAGGTCAAGAAGTGGTCGCCCTCGGTCTGTTAGGACTCCAGCAGTGATAAAAGCTGTGAAAGCGCGAATTCAAAGAAATCCCAAACGTAAGCAGAAACTGTTGGCCCTTCAGATGGGGTTAAGCAGAACCACGGTGAAAAGGGTGTTAAATGAAGACTTAGGGCTTCGGGCACATCGAAGTAAAACAGGACATCGTTTGAATGCTCGTCTAATGGACCTGAGACTGAAGAGATGCCGCGCTTTGTTGAAGCGTCCTGACGAACCTTGTGGAACCCAGTCGTCGGTGCGCCCAGTCACGGCCGGAGTTCCCCAGGGAAGCGTCCTGGCACCAGTCCTCTACGCTCTCTACACCAACGACATTCCCACGCTCGAGGGCAACCTCCAAGCGTGGGAAGCCGACGTGAAGTTGGCGCTGTTTGCCGACGACAACGCCTACTTCGCGTCCTCAAATTTCCTCTCTGCGGCCATTTCGAGGATGCAGAGGCTGTTGGACCTACTGCCCCAGTGGCTGGACCGATGGAGGGTCGCGATCAACGTGGGGAAGACCGCGGCTATTCTCTTCGGTCCGGTCCGCACAAGAGTCGTCCCAGGACAGCTCAGTCTTCGTGGAGTCAATGTCGAGTTTAGGCCCAGTGTCCGATACCTTGGAGTCAATATCGACCGGAGTTTGAGGATGACCGCCCACGCCAAGTCGGCGTTGGCGGCCGCCCGCTACGCGAGGTTTCTCCTCCGGCCGGTGTTGGCCTCCAGGTTGCCGACCAGGACTAGACTCGGCATTTACAAGACGTATGTTCGTTCCCGTATCACGTACGCAGCTGCGGCCTGGTATCACCTCATCCCGCAGGTCATGCGGGTGAAGTTACAGGCCCAGCAGAATCTGGCTCTTCGCACGATAGTCGGAGCAGGGCGTTACGTCAGAAATGACGTAATCGCCCGGGATCTAGATGTGGAGTCGCTCGAGGAGTTCATCCGGAGGCTAGCTCGTAACATGTACGAGCGGGCTGACGGTGGACCCCACGAGCATCTCCACAATATAGCTCCCTTGCACGCCAGACCACCTGATGGTAGGGCGCTACCAAGGGAGCTACTGGAACCCCCTTCTATGGCCCCCTTCATCCCGTCCTGCATAATTTCACCCCTGCCCTGTGTGGCAGGGAGCTTCGTTCCGGGCAGTGGGGTTTGCCCCGAGGCCCGTTCCGTGCCCCCGAAAGGGGGTACGACGACCCTCCTTCTTCTTCTTGTGGAACCTGTTTCTCATACCATGTTCAATAACAGGCACTGGGTATTCCAACAAGATTCGGCGCCAGCTCATAGAGCGAAGAGCACACAAGACTGGCTGGCAGCGCGTGAAATCGACTTCATCCGGCACGAAGACTGGCCCTCCTCCAGTCCAGATTTGAATCCGTTAGATTACAAGATATGGCAACACTTGGAGGAAAAGGCGTGCTCAAAGCTTCATCCCAATTTGGAGTCACTCAAGACATCCTTGATTAAGGCAGCCGCCGATATTGACATGGACCTCGTTCGTGCTGCGATAGACGACTGGCCGCGCAGATTGAAGGCCTGTATTCAAAATCACGGAGGTCATTTTGAATAA
Protein
MLKNLNITKIFVYRTIKRYNEDSSVDDRSRSGRPRSVRTPAVIKAVKARIQRNPKRKQKLLALQMGLSRTTVKRVLNEDLGLRAHRSKTGHRLNARLMDLRLKRCRALLKRPDEPCGTQSSVRPVTAGVPQGSVLAPVLYALYTNDIPTLEGNLQAWEADVKLALFADDNAYFASSNFLSAAISRMQRLLDLLPQWLDRWRVAINVGKTAAILFGPVRTRVVPGQLSLRGVNVEFRPSVRYLGVNIDRSLRMTAHAKSALAAARYARFLLRPVLASRLPTRTRLGIYKTYVRSRITYAAAAWYHLIPQVMRVKLQAQQNLALRTIVGAGRYVRNDVIARDLDVESLEEFIRRLARNMYERADGGPHEHLHNIAPLHARPPDGRALPRELLEPPSMAPFIPSCIISPLPCVAGSFVPGSGVCPEARSVPPKGGTTTLLLLLVEPVSHTMFNNRHWVFQQDSAPAHRAKSTQDWLAAREIDFIRHEDWPSSSPDLNPLDYKIWQHLEEKACSKLHPNLESLKTSLIKAAADIDMDLVRAAIDDWPRRLKACIQNHGGHFE

Summary

Uniprot
ProteinModelPortal
PDB
5CR4     E-value=6.97161e-09,     Score=146

Ontologies

Topology

Length:
558
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.0944000000000001
Exp number, first 60 AAs:
1e-05
Total prob of N-in:
0.00543
outside
1  -  558
 
 

Population Genetic Test Statistics

Pi
182.742023
Theta
124.509777
Tajima's D
1.945712
CLR
14.417244
CSRT
0.871956402179891
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号