SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15216  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004960
Annotation
PREDICTED:_claspin_homolog?_partial_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.026
 

Sequence

CDS
ATGCATTATAGCGGTACTCCTGCTGAGAAACGCGAAGGTCTTACTCCAGAACCTGAAACAGAACAAATTGAAATTCCAGAAAAAAGAAACAACATTAATGAGAACTTACCTTTTCAGGAACCTAACCCCCTTTATTCCAGCTCTAGTCAAGATCATGTTGATGAACCATCTCCCTCAAGTGGAAGACCACAAAGGGACGTGAGACCACCAGCATGGACCAAAGATTATGAGTTAAGTCGCTGCGTGACCATGTTTACGTCAGAAAATAATGACGACTATGACTGCTCTTTACTAACATACAAAGAAGCTGTGACTGGCACCGACAGACGAAATTGGGAGAAGGCGATACAATCTGAAATGGAATCATTACAGAAAAATAACACCTGGCTATTAGTAGACAAGTCAGAAGCCAAAGGACACAAAATACTGTCGAACAAATGGGTATTTCGGATTAAAGATGACGGTACGTACAAGGCTAGATTAGTCGTACGTGGATGCGAGCAGAAAGGAAACCTGGATTTCGAAGACATTTATAGCCCAGTAGTAAGTCAATCTGCATTAAAAACTTTATTAGCAATTGCCGCATCTAAATCTTACTACTTCATGACATTTGACATCAAGACAGCTTTCTTATACGGAGAGTTATCAGATGAAGTTTATATGAAATTGCCTGTTGGCTATGAGAATAACTGCAATACTACTGAAGTAGTTTGCCGATTAAAAAAATCTTTGTACGGATTAAAACAAGCTCCATTTACATGGAACAAAACTTTTACCCAAGCGATGTTTGATTTGGGATTCAAGACAATCAAAACAGATCGATGCGTTTTCATAAACGAAGATAAATCAATAATAATCGGACTATTCGTTGATGATGGACTTGTCATAGGAAAAGATAAGAAAAAGATCGAAGCTATTTTGAAGAAACTTGAAACCAAATTTCAAATGAAAAAGAATGAAAATCCAAGTACTTATCTGGGTATGGAAATAAAAAACTCAAAAGAAGGAATAGTTCTTACTCAGAGATCCTACATAAATGACGTACTGGAAAAATACAACATGAAAAATGCCAAACCTTGTGACACGCCCGCAAGTAGCGATTCAAAGTCGATACAGGAAACTGCCCAGGAGAAGGAATATCCCTATAGGGAAGCAGTGGGAAGTTTACTGTACCTGTCTACCAGAACCAGACCAGATATCGCACAAGCGGTCAATCTAGTTAGCAGGAAGGTCGAAAACCCTACTAGAGAAGACGTTACCAAAGTCAAGAAAATATTCAAATATTTAGTGGGAACCAAACATAAAGGCATTTTATTCAAACGAAACAAACCGATAGAGAGCATCGATGCTTACAGTGACTCGGATTATGCTGGAGACCCATTGACGAGAAGAAGCACTTCTGGTTCCGTGCTAATGATAGCCGATGGACCAATATCATGGGCATCCAAGAGGCAGCCTATAGTAGCGCTATCGTCGACTGAAGCCGAGTACATAGCCGCAGCAGACTGTTGCAAAGAGGCATTGTATCTCAAATCTCTATTGCAGGAAACAACCGGTTTGGACATAAAAATAAATCTACATGTTGATAACCAAAGTTCGATTCAACTTGTGAAGTCTGGATCCTTCAACAAAAGTGCCACTATGAAAACGGAAGGCTTAGAAACGAAAGGTGTGGAAAAGTTGTGGTGTGGAACCAATATCAACGAAAACGATTCTGTCTCGGAAAACATGATAACAGTGCATGATAAAAGCATAAGCTTAGCAATAAAATCCAGTGCAGGTCGCAGCGATACAAGTGATGAAGATGGGATACCCGTAGTACGAGTGAAAAGGCGTGTTAAGCAATTTTCTGATAGTGGTAGTGATATCGACAAGGAGATTTTGCATAAATATAGCCAAAATGCAGATTCAAGTTCTGATAGCGAAAATGGAGTTTACAAGCTTACAAATAAGCAGGCCAAGAAAAATTCAGATTCAAATTCATTTAATTCAAGAGAAATAAAATCACTGAAAAATGATCAGCAACAACTGAGAATGAAAAATAAAAGAAATAAACTGAGGGAAAAGTTTAAGAATTTAGTCCAAACAAAGGGAAAAGTAAAACAGCAGAATATCAGTGAGAGTGAGAAAGACAGTAAGAAAATATCAGAAGATTCTGAAGATGATGCTGCCTCTGTGGATAATATTAAACAAAAAATCAAAGAGAAACTTAAAATTGAACCATCACACTTTAAACTGTCTGTTTGTGATCCTGACACATCCTCAGATGAAGAAGAGAAAGAACTGGAGAATATTAAGCTGAAACTTTCAAAACAAAATAAAAAAAGTAAATGTACACAACCAACATCTCCTAAGCCTATGAGAATGACAGCTAAAATAGCTATGGAAAATATGCAAAAAATAAAGAGTGAATCTAATAGAATGCTTAGAGAAAAACAAGTGTCATTACCATACCACAGACCAAAAGCTTTGTCTTTAAAAGACATAATGAGTAGAAGAAAACCAGCTGTATCTGCTGATGGAAAAGCATTACCAATAAAAATGAATGAAGAACAATTAAAGCAATATGCCCAACAGCTCAACGAGAGGCAAAAAGAAATGATGGAGTTGTGTAAAAGTGATACTGAAGATGAAAATGACAGTGACAATATAAAGACTAATATTGAAAATAATGAGGTTAAAGAATCTGTGAACAATGCTAGTCTGTCTGTAGATAAACTCTATACTGAAAAAGATAATGTAGTAACTGAAAATGTGCAAAATGAATTAAATCTTGATCAAAATGAGGACAGCTCAGATTTAATTCGCAAAGAGAACGGTTTGAATTCTAGTGAAGAGAAAATATTAGATGAAAAGGATAAGAGTATTACAAAACAAAATCATCAAGTTGAGATTACTGAAGCTCTCACAGAAGGTTTTGTTTCTACAACAAGAGATGATCAAATAAATACATTAAATAATGTAATATACAATCATTTTGATAACTCAACTGATAGTAGTAATATTAATGCACAAACTCAAAGAGATAGTGAACAAATATCTTTACATTTTGACTCTGAAACTTACACAGATAATAAATTAAAAAGCGATGAAAACTGTTATAACAAAGAGACGACACTTGATCAAACTGAAAATTATGATTTGTTTGATGACTATTCCGATCAACATATGAATATGATTAATATTGAGAACATTGTAAATAATGTAGAAGTAAATAAGGCAAAGGATCAAACCTTAAATATCAAACCTAAACTGACTGGTGCTCCTGGAATGGTTATTGATTTGGATGATGGTGATCCTACAATACCAAAGAAACTATCTGGTGTTGAACTACTGAAAGAAAGGTTTACTTATTTTGCCAAATTAAAAACTCCAGAGGAGGCGGAACGAGAGAGGGAGAACAGATTAAAGCCAGGAGCACTTTTATTGAAACTAAAACAAGAGCTGGAAGAAGAAATTGCTGAAAAACGATCTTTGGAATGGGCGAGACGATTAGAAGAAGAGAAAAAGCAAGAATTGGAGCTAAAAGCTCTTAGAGGGGAAACTTCAGAAGCTGAAGACGAAATTGAAAAACTTGATCGATTAGGAGAAAACCTCGAAAAAGAATCTTCTGGAGAATCGGAAGAAGATTTAATAGAAGATGACATAGATATGGTGGATAAATCTCCAAATAAAAATACTTTTATTACTGATGAGGCTGAGGAATCCGAATGTGACGACGATGTAGCTGATGATCAAGTAGATAACCCATTAGATAGTGACAATAATGAAAAACAAATTGAAGACGAGGCCGGAGATAGTGAAATTAATGAAGATGATGAAACTAGTGAATCATCTGAAGAAGAACACACTACTGTCGGGAAAAAGGGTAGAATATTAAAAGCATTTGAAGATTCTGATGATGAAGAACGTAATGATGACCTTAATCTAGAAAGTAACAATATGTTAAAAGTTACAAGCCAGTTCAAAGCAAACATAGAAAATAGCATTGATAGATCAATTGAAACTGAAGAAAGGTCGGTTGAAAAAGAGAAAATTCAAACAATTAGCGATTCTCAAGATGACATTATTCAACTGGCTCAAGCACATAAATCTGTATCAGATGAACTATTCACAAGTCTGGAAAGTGTTTTAGTAGTTTCTGATAAAAATATCAAAGAAGATGAGGAGAGTGACTGTCAAACACAAACATTTTCAATATTGAAATCTATTAACGGAATTGAAAATGAATTGGGTACAGAGGATAGCGAAACACCATCACTTAATAGCCTCAAAGAATCTGATACTAAAGGATGGAAAGAATGTTTGGGTCCATCTAAATTACTAAACACACAAAATTCTCAAGCGTCAACCTCACAGCCAATCGGCGAAGATATTTTAGCCCTTTGCACCGGCCAGTTCTACGAAAATGAATTCATTTCCCAAATTAATGAAGAAGATAAAAATGTACTTCATTTTATTAATGAGGAATTTGCAGGCAAGAATGATATAAATATGTCGTCAGGTCAAGAAAAAAACAGTGCTGAAGATTTAACGCAAACAGTTAATAATTCTGATGCTATTAACACTGTAAAGCCCAAAGACGATGGAATACTTCTACAATCAATACTTGATGAATTACATGATCCCGAATTTGATACCCCAAAACAAAATAAATATTTTTGTGGGAGCTTAGATTCGAATATTAAAAAGAAATTCATCATTGATTCGGACGATGAAGAAAATAAAACTGAAGCCAAAGTTGGTAAAAATCATAAAAAGAAGAAACGCGAAAAGCGAGCTTTGCAGATTTCAGATGACGAAGATGAAGACGAAGAATTAGAAGAAACGGAAGAATATCAATCGGAAATCGACGATAATAATGATGATGATGCTGACAGAAATGATAAAATAGTAGAATATGATTCTGAGGAAAATGAGGTGGAAGTCAAAGTTCAATACACTAAGAAAAAACGTACAACGACAGAGTTTTTCGAGAATGAAGCAGAATTGACTTCAGAAGATGAGTGGATTGGTTCCGGCGATGAAGACGAGGCTGGTCTCGACCGTATGGAACGAGAAGAAGGAGATGATGAGACATTTAATCAGAGGAAACTGCAAAGGGAACTTGGACAGATACACATGCGCGACGTAATGGATCAAGACAAACGAGAAGTGCGTATTATTCAAGAACTGCTGTTCGAAGACGGTGATCTCGGAGATGGGCATCGTCAGCGGAAATTCAGATGGAGAAATAATGAGGACGATGAACAAATGGGTACAATTGTGGGTGATTACACTGATACGCAAGAAGAAGACTTTGAATCTGAAGAACAATGGAGAAAACAGAGGCACGAGAGGGAGATATTTTTAAAACAGATGCAAAGCAAAGATGACAATGAAGACTGCAACATAAGTATAGATCGGACAACTATAATTAAAGCTAATTTATGTTCGAAGACAATGTCGACATTGCTTCAAGAAATGAAAAAGACTGACACACGAAAGACTGAAGACCAAGAAAAATATATTAGCGCGGAAAAGAAATCGACAAGAGATATACCTAGTCCAAAGAAGGCTTATTCTATATTCCAGCAAAACTACCATGGTTCACTACTAACACGTGGTAACGGTGCTCTAGCCCGTTTAGCGGCGCTTGCAACTCCATTGGCGATCAATGACGATTCTCCTAAAGTTGGCTCTTTAGTTCCTACCAACAGAAGAAACTTCGTCTTTTCCTCCGTTACACCTGATAAAGAACCAAAGGGAATGAAAAGAAAGGCGGATAGTAAACCTGACACGCCTCGACTTATGAAGAAACTGAAAGCGACAGACAAGCAAACGCTTTCCAAGAATAGTTTGTTAGACCATTTGAAGGTGTAA
Protein
MHYSGTPAEKREGLTPEPETEQIEIPEKRNNINENLPFQEPNPLYSSSSQDHVDEPSPSSGRPQRDVRPPAWTKDYELSRCVTMFTSENNDDYDCSLLTYKEAVTGTDRRNWEKAIQSEMESLQKNNTWLLVDKSEAKGHKILSNKWVFRIKDDGTYKARLVVRGCEQKGNLDFEDIYSPVVSQSALKTLLAIAASKSYYFMTFDIKTAFLYGELSDEVYMKLPVGYENNCNTTEVVCRLKKSLYGLKQAPFTWNKTFTQAMFDLGFKTIKTDRCVFINEDKSIIIGLFVDDGLVIGKDKKKIEAILKKLETKFQMKKNENPSTYLGMEIKNSKEGIVLTQRSYINDVLEKYNMKNAKPCDTPASSDSKSIQETAQEKEYPYREAVGSLLYLSTRTRPDIAQAVNLVSRKVENPTREDVTKVKKIFKYLVGTKHKGILFKRNKPIESIDAYSDSDYAGDPLTRRSTSGSVLMIADGPISWASKRQPIVALSSTEAEYIAAADCCKEALYLKSLLQETTGLDIKINLHVDNQSSIQLVKSGSFNKSATMKTEGLETKGVEKLWCGTNINENDSVSENMITVHDKSISLAIKSSAGRSDTSDEDGIPVVRVKRRVKQFSDSGSDIDKEILHKYSQNADSSSDSENGVYKLTNKQAKKNSDSNSFNSREIKSLKNDQQQLRMKNKRNKLREKFKNLVQTKGKVKQQNISESEKDSKKISEDSEDDAASVDNIKQKIKEKLKIEPSHFKLSVCDPDTSSDEEEKELENIKLKLSKQNKKSKCTQPTSPKPMRMTAKIAMENMQKIKSESNRMLREKQVSLPYHRPKALSLKDIMSRRKPAVSADGKALPIKMNEEQLKQYAQQLNERQKEMMELCKSDTEDENDSDNIKTNIENNEVKESVNNASLSVDKLYTEKDNVVTENVQNELNLDQNEDSSDLIRKENGLNSSEEKILDEKDKSITKQNHQVEITEALTEGFVSTTRDDQINTLNNVIYNHFDNSTDSSNINAQTQRDSEQISLHFDSETYTDNKLKSDENCYNKETTLDQTENYDLFDDYSDQHMNMINIENIVNNVEVNKAKDQTLNIKPKLTGAPGMVIDLDDGDPTIPKKLSGVELLKERFTYFAKLKTPEEAERERENRLKPGALLLKLKQELEEEIAEKRSLEWARRLEEEKKQELELKALRGETSEAEDEIEKLDRLGENLEKESSGESEEDLIEDDIDMVDKSPNKNTFITDEAEESECDDDVADDQVDNPLDSDNNEKQIEDEAGDSEINEDDETSESSEEEHTTVGKKGRILKAFEDSDDEERNDDLNLESNNMLKVTSQFKANIENSIDRSIETEERSVEKEKIQTISDSQDDIIQLAQAHKSVSDELFTSLESVLVVSDKNIKEDEESDCQTQTFSILKSINGIENELGTEDSETPSLNSLKESDTKGWKECLGPSKLLNTQNSQASTSQPIGEDILALCTGQFYENEFISQINEEDKNVLHFINEEFAGKNDINMSSGQEKNSAEDLTQTVNNSDAINTVKPKDDGILLQSILDELHDPEFDTPKQNKYFCGSLDSNIKKKFIIDSDDEENKTEAKVGKNHKKKKREKRALQISDDEDEDEELEETEEYQSEIDDNNDDDADRNDKIVEYDSEENEVEVKVQYTKKKRTTTEFFENEAELTSEDEWIGSGDEDEAGLDRMEREEGDDETFNQRKLQRELGQIHMRDVMDQDKREVRIIQELLFEDGDLGDGHRQRKFRWRNNEDDEQMGTIVGDYTDTQEEDFESEEQWRKQRHEREIFLKQMQSKDDNEDCNISIDRTTIIKANLCSKTMSTLLQEMKKTDTRKTEDQEKYISAEKKSTRDIPSPKKAYSIFQQNYHGSLLTRGNGALARLAALATPLAINDDSPKVGSLVPTNRRNFVFSSVTPDKEPKGMKRKADSKPDTPRLMKKLKATDKQTLSKNSLLDHLKV

Summary

Uniprot
ProteinModelPortal

Ontologies

GO

Topology

Length:
1953
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.01051
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00049
outside
1  -  1953
 
 

Population Genetic Test Statistics

Pi
243.593898
Theta
206.105949
Tajima's D
0.727985
CLR
12.068834
CSRT
0.586320683965802
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号