SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15200
Annotation
Yokozuna_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.966
 

Sequence

CDS
ATGGCGGACGACGCTTCAAGAAAATTACTTCCAGAGTTTACTGGAACTAATTTCAGCACGTGGATATTTCGAATATCATGCATCCTAGAGGAAAAGGAATGCAAAGAAGCAATTGAAGATGGCATAACAGAGGAAATATTGAAGTCAGAAAAATTCAAAAAGAAAGACGCAAAAGCTAGAAGTTTGATAGTCAACTGCCTCTCAGACAAACACTTGGAATACGTCAGAAGCGCTACGAGTGCAAAAGAGATGATCGAAAACTTACGAAAAATATTCAAAAGAAAAAGTACGTTATCTGCGTTATACGTCAGGAAGAAATTATTAACCTTAAAATGTGACCCCAGTGTCGAACTGAGCGACCACTTCAACAATTTTGATATGTTAATAAGACAATTAGAAGAAACTGGAAGCACTGTAAATGAACAAGACAAGGTGTGCCACTTACTACTGACTATGCCTGACAGCTACAATACTACAATTGCCGCCTTAGAAACTACTAATGTGGAACTCACAACAGAGTATGTCAAAAGCAAATTGTTAGATGCAGAACTAAAAAACCAAAATAATTCAATGGAATCACAGGATGCACACAGCTTCCTCAGTTGCTTTAAATGTGGTAAAACTGGTCACAAAGCTATACAGTGCAGAACTGGACACTTAATGAGAGGACAGCATCGAGGCAAAATGGGCAACGTCGGATATTTCAACGGAAGTTACACTAGAGACTTCTATCGAGGCAACGGCAGAGACTTCAATCCAGGTAACGGCAGAGGCTTTAACCGAAGCAATCCCAGAGGCAACGTGAGAGGACAATCGAGGGGATCATCAAGGGACACCATACTCCAACAAGGAAAAAGTGCTTTAAGTGAGAGAAATCCATTTTCTTTTGTTGCCAGTGAAAAGGTACTATCTGTTGATGTGTATAATGAGGACATTAAGTTTATTATTGATTCAGGAGCATCTCAAAATTTAGTCATTGATAGTTATGAAAAGTACATGTCAAACATTGAATATTTAGAAACTAAAACTAAGATTTATGTTGCTAATGGTCAATATTTGTTTTCAAGTAAAAAAGGGATTTTAAATGTAAAATATAATAACTTACCTATTAAAATAGAAGCACTACTTGTCAAGGGGCTATCCCACAACTTATTATCTGTTAAAAAATTATTAGAGAAAGGAAATTCTGTCAGATTTCATAAAAATTCTGTATCAATTGCTAAAGGAAATAACATAATTTATGGTACCATGCTTAATAGTCTGTATGCAATCAATCTAACATTAAACTTAGAAAAATGTTATTCGATAAATAATGATAAAGATCTATGGCACAAAAGGTTAGGACATGCTAATAGAAAACACTTAAAATTATTGAAATTACCTATCTCAGAAAAACCATGTGGAATATGTGTAGAAGGAAAATCAACAAGATTACCATTCTCTACAACACCCAAGCCGAGATCAAAGTATATAGGAGAACTCATACACACAGATATATCAGGACCAATAAATATTCCTACACTTACAAATGAGGTATATTTTCATACAATTATAGATGATTACACACATTTCTGTGAGGTATACTTATTACAAAGAAAAAGTGAGGCAACCGATAGGCTCATAGAATATGTTAATAGAATGGAAAGACAAATAGAATGTAAAGTCAAGAAAATCAGAAGTGATAATGGTGGTGAGTTTAAAAATGAAAAACTAAATAAATTTTGCAAAGATAAGGGAATTGTTCAACAGTTTACTTTGCCTTATAGCCCACAATCAAACGGAGTTTCAGAACGCATGAACAGAAATATTTATAACAGAGCTCGGACTTTATTAATTGAATCTGGTTTACCAAAAACCTTATGGGGTGAAGCGGTGCGATGTGCTGTCTATCAAACCAACAGATGTCCATCGTCTGCTATCAACTTTCAAACTCCAGCAGAGAAAATGTTTGGAAACAAAGACTTAACAAGACTTAGGATATTTGGATCAAAATCATGGGTTCATATCATACCAAAACAAGATAAACTTTTACAAAGAGCTAAAGAAATGAGACTCGTAGGATATAGCCCAAATGGATATCGTCTATGGGACCCTACAAGTAATAAAGTGATAGTGTCAAGAGATGTCAGAATTGATGAAACTCAATTAAACTACAAGGAAACTGAAGAAAAGCATAACATAAAAGGAGAAACATACTATGAAGATGAATTAATACAAAATGAAGATACTGAGAAGGACACAAAAGATGACCAAGAGATAAGAATACTTAATGAGAATGATGAAAACATGCAACATGATAGAATACCTGATAAAACAAATAAAGAAGTATCAAAGAATAATCAAGATGATGAAGAAGAAAATGAAAAATTGAATAAAAAAGGTAGAATAAATATACAGAAATATATAACAAGATCAGGAAGAGAAATTCGCAAACCAAAAAACTTAGAAGAATATGATCTAAATATAGCATACTGTCTTTTATCGGGAGATCCACAAGAATTTGAAGATGCAATTCATGACAAAGACTGGGAAAAAGCAATAAAGACAGAATTAAATTCACAAGTGAAATTAGAGACATGGGAAGAAGCTACATTACCAATGGGAAGTAAAGCAATAGACACAAAATGGGTATTCAGAACTAAACAAAATGGAACCAAGAGAGCTCGATTAGTAGCGAAAGGTTTTCAGCAACAGAACAATGATAATCATTATGCTCCGGTAGCCAAATTGTCAACTATCAGATTAATGATGAGTTTAGCAGTTCAACTGGATTTGTCATTAAAGCAATTGGACGTACCAACAGCCTTCTTAAATGGAAAATTAAATGACAATGTCTATATAAAATGTCCCAAAGGAATGGAAATTAGTGAAGGAAAAGTTTTAAAACTTAAAAGGGCTTTGTATGGATTAAAAGAAGCACCTAAATGCTGGAATCAAAGATTTAATAATTTTGTCATTCAGAAAGGGTTTGTACAATCACAGCATGATTTATGTCTATATGGAAAAGGAAAAATCTGGATATTACTCTATGTGGATGATATTTTATACCTTGGAAATAGCAATGAGATGATAAAGGAATTAGAAAAGGAATTTAAAGTAAAAAACTTAGGAGAAGTACATCAATATTTAGGATTGGAAGTAACAAGAACAGAAGACAGCTTGGAAATAAGACAAACAGAAATAATTAAAAGACTCCTGGAGAAATATCACATGCAAGATTGCAAATCAAGCAAGACTCCAATGGAAATTAATTTTAATGTAAACATTCCATCACCATCAGATATAATTGAAGTACCCTTCAAGGAATTAATAGGATCTTTGTTGTACATTGCTGTGAATAGTCGACCGGATATTGCTTATGCTGTATCATTCTTAAGCAGATTCTTAGATAAACCCACACAAGAATTATGGACAGCAAGTAAGAGAGTGTTACGTTATCTTAAAGGAACCTCGCATCAGGGACTGATTTATAGGAAGACCGAAGAGTACACAAAACTTATAGCCTACTCAGACGCTGACTGGGCAGCAGATAGAACAGACCGTAAGAGCACAAGTGGCTGTGCTATATATCAAGGCCAGAACTTAATAACTTGGTTCTCTAGAAAGCAAACATGTACCGCCCTGTCAACAGCTGAAGCTGAGTATGTGGCTGGAGCACACTCAATGAGTGAACTTATTCACATCAAAGGATACATACATACTTTCTGA
Protein
MADDASRKLLPEFTGTNFSTWIFRISCILEEKECKEAIEDGITEEILKSEKFKKKDAKARSLIVNCLSDKHLEYVRSATSAKEMIENLRKIFKRKSTLSALYVRKKLLTLKCDPSVELSDHFNNFDMLIRQLEETGSTVNEQDKVCHLLLTMPDSYNTTIAALETTNVELTTEYVKSKLLDAELKNQNNSMESQDAHSFLSCFKCGKTGHKAIQCRTGHLMRGQHRGKMGNVGYFNGSYTRDFYRGNGRDFNPGNGRGFNRSNPRGNVRGQSRGSSRDTILQQGKSALSERNPFSFVASEKVLSVDVYNEDIKFIIDSGASQNLVIDSYEKYMSNIEYLETKTKIYVANGQYLFSSKKGILNVKYNNLPIKIEALLVKGLSHNLLSVKKLLEKGNSVRFHKNSVSIAKGNNIIYGTMLNSLYAINLTLNLEKCYSINNDKDLWHKRLGHANRKHLKLLKLPISEKPCGICVEGKSTRLPFSTTPKPRSKYIGELIHTDISGPINIPTLTNEVYFHTIIDDYTHFCEVYLLQRKSEATDRLIEYVNRMERQIECKVKKIRSDNGGEFKNEKLNKFCKDKGIVQQFTLPYSPQSNGVSERMNRNIYNRARTLLIESGLPKTLWGEAVRCAVYQTNRCPSSAINFQTPAEKMFGNKDLTRLRIFGSKSWVHIIPKQDKLLQRAKEMRLVGYSPNGYRLWDPTSNKVIVSRDVRIDETQLNYKETEEKHNIKGETYYEDELIQNEDTEKDTKDDQEIRILNENDENMQHDRIPDKTNKEVSKNNQDDEEENEKLNKKGRINIQKYITRSGREIRKPKNLEEYDLNIAYCLLSGDPQEFEDAIHDKDWEKAIKTELNSQVKLETWEEATLPMGSKAIDTKWVFRTKQNGTKRARLVAKGFQQQNNDNHYAPVAKLSTIRLMMSLAVQLDLSLKQLDVPTAFLNGKLNDNVYIKCPKGMEISEGKVLKLKRALYGLKEAPKCWNQRFNNFVIQKGFVQSQHDLCLYGKGKIWILLYVDDILYLGNSNEMIKELEKEFKVKNLGEVHQYLGLEVTRTEDSLEIRQTEIIKRLLEKYHMQDCKSSKTPMEINFNVNIPSPSDIIEVPFKELIGSLLYIAVNSRPDIAYAVSFLSRFLDKPTQELWTASKRVLRYLKGTSHQGLIYRKTEEYTKLIAYSDADWAADRTDRKSTSGCAIYQGQNLITWFSRKQTCTALSTAEAEYVAGAHSMSELIHIKGYIHTF

Summary

EMBL
AB014676    BAA74713.1    GBHO01027564    JAG16040.1    GEDC01012841    GEDC01000503    + More
JAS24457.1    JAS36795.1    GBHO01035173    JAG08431.1    GBHO01004832    JAG38772.1    GDHC01019310    JAP99318.1    GDHC01007058    JAQ11571.1    GEZM01072005    JAV65635.1    LBMM01007046    KMQ90088.1    GEZM01028916    JAV86196.1    GBBI01004033    JAC14679.1    GFTR01008662    JAW07764.1    ABLF02041793    GBHO01036606    JAG06998.1    GBHO01036607    JAG06997.1    GBHO01002761    JAG40843.1    JN402333    AFB73912.1    LJIG01022881    KRT78250.1    OIVN01002055    SPD00174.1    OIVN01000991    OIVN01001835    SPC88370.1    SPC98114.1    GDUN01000694    JAN95225.1    LBMM01012772    KMQ86003.1    GEZM01032204    JAV84770.1    KF740825    AIC77183.1    GEHC01000966    JAV46679.1    CM003606    KYP69041.1    KQ483623    KYP44533.1    CM003608    KYP66220.1    OIVN01001931    SPC99063.1    OIVN01006387    SPD32065.1    JYDL01000068    KRX18751.1    FJ225394    FJ225395    ACN78973.1    OIVN01006466    SPD33659.1    GGFL01004951    MBW69129.1    PDCK01000039    PRQ60431.1    OIVN01001308    SPC92446.1    GGFM01000952    MBW21703.1    OIVN01004651    SPD18552.1    CM007893    OTG30017.1    NKQK01000002    PSS35035.1    GGFM01000953    MBW21704.1    AB005236    BAB09923.1    OIVN01006211    SPD27863.1    GBHO01024362    JAG19242.1    OIVN01002473    SPD03944.1    GEZM01063091    JAV69316.1    KQ461175    KPJ07802.1    ASHM01014513    PNX96445.1    GECL01003258    JAP02866.1    JYDP01000258    KRZ01816.1    OIVN01004766    SPD19126.1    GEVI01026597    GEVI01022915    JAU05723.1    JAU09405.1    ASHM01013569    PNX95528.1    GBXI01011094    JAD03198.1    GEZM01044912    JAV78046.1    PKPP01000428    PWA92889.1    EF094939    EF094940    ABO36622.1    ABO36636.1    NKQK01000016    PSS08126.1    CM007900    OTG06758.1    GDHF01029905    JAI22409.1    GDHF01000873    JAI51441.1    JAV86195.1    LBMM01012368    KMQ86259.1    ASHM01014140    PNX96091.1    DF973265    GAU23220.1    GBXI01017107    JAC97184.1    PDCK01000041    PRQ42077.1    ASHM01014005    PNX95963.1    GEVK01019149    JAU33683.1    X13291    CAA31653.1    DF973673    GAU37486.1    ASHM01013227    PNX95204.1    NEVH01009420    PNF33053.1    AC149577    ABD32582.1    PDCK01000040    PRQ52345.1    OIVN01000160    SPC75452.1    KQ484948    KYP33249.1    LXQA010000742    MCH80155.1    ASHM01012734    PNX94698.1    DNYX01000353    HBK84078.1    OIVN01002984    SPD07941.1    NEVH01006980    PNF36330.1    GAMC01018338    JAB88217.1   
Pfam
PF00665   rve        + More
PF07727   RVT_2
PF13976   gag_pre-integrs
PF00098   zf-CCHC
PF13961   DUF4219
PF04500   FLYWCH
Interpro
IPR036397   RNaseH_sf        + More
IPR039537   Retrotran_Ty1/copia-like       
IPR001584   Integrase_cat-core       
IPR013103   RVT_2       
IPR012337   RNaseH-like_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR025724   GAG-pre-integrase_dom       
IPR021109   Peptidase_aspartic_dom_sf       
IPR025314   DUF4219       
IPR007588   Znf_FLYWCH       
SUPFAM
SSF53098   SSF53098        + More
SSF57756   SSF57756       
Gene 3D
PDB
3S3N     E-value=4.66666e-08,     Score=142

Ontologies

Topology

Length:
1235
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00805999999999999
Exp number, first 60 AAs:
0.00128
Total prob of N-in:
0.00021
outside
1  -  1235
 
 

Population Genetic Test Statistics

Pi
408.118205
Theta
225.041338
Tajima's D
2.524604
CLR
0
CSRT
0.947352632368382
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号