SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15169  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004980
Annotation
Serine/threonine-protein_phosphatase_2A_56_kDa_regulatory_subunit_alpha_isoform_[Papilio_xuthus]
Full name
Serine/threonine protein phosphatase 2A regulatory subunit      
Location in the cell
Cytoplasmic   Reliability : 4.084
 

Sequence

CDS
ATGTCTTCGGGAACGTTTGTGGACAGGATTGATCCATTTGCTAAAAGATCACTGAAGAAAAAGACTAAGAAGTCTCAGGGTTCCTCTCGTTATCGTAATACGCAAGATGTGGAGCTACAAGCATTGCCATTGTTAAAAGATGTCCCAAGCAGTGAACAAGAGGAATTGTTCATCCGTAAACTCCGACAATGTTGTGTGGCGTTTGATTTCATGGATCCTGTTGCTGATTTGAAAGGCAAAGAGATCAAACGTGCTACACTGAATGAACTTGTTGAGTACATTCATGGTGGCCGCGGTGTACTTACAGAGCCTGTTTATCCAGAAATTATAAAAATGATATCGGCAAATCTGTTCCGTACCCTGCCTCCAAGTGAAAACCCTGATTTTGATCCTGAAGAGGATGATCCGACTCTGGAGGCGTCATGGCCCCATCTTCAACTAGTCTACGAATTCTTCCTGCGCTTCCTTGAGTCAACTGATTTCCAACCTACTATAGGCAAGAAGGTTATCGATCAAAAATTTGTTTTACAGCTTTTAGATTTGTTCGACTCTGAAGATCCGCGCGAGCGCGATTTTCTGAAAACCGTGCTACATCGCATCTATGGAAAATTTTTGGGTCTGCGAGCATTTATACGGAAACAGATCAATAATATATTTTTGAGATTTGTCTATGAAACTGAACACTTCAATGGTGTTGGTGAACTGCTAGAAATATTGGGAAGTATAATAAACGGATTCGCCTTACCGTTGAAGAGTGAGCACAAACAATTTTTGGTGAAGGTGCTACTGCCTCTGCACAAGGTGAAGTGCTTGTCATTATACCACGCTCAGCTTGCCTACTGCGTGGTTCAGTTCCTCGAGAAGGACGCTACGCTCACGGAGCCCGTTGTGCGTGGACTACTCAAGTTTTGGCCGAAGACTTGTTCACAGAAAGAGGTAATGTTTTTGGGCGAGATTGAAGAAATATTGGATGTAATTGAGCCTGCACAATTTGCTAAAATCCAAGAACCACTGTTCCGGCAAATTGCAAAATGTGTTTCCAGTCCTCATTTTCAGGTAGCTGAGAGGGCTTTGTATTTCTGGAATAACGAGTATATAATGTCGTTGATGGAAGAGAACAACCATGTGATCATGCCTATAATGTTCCCAGCGTTGTACCGAATCAGCAAGGAGCACTGGAACCAAACAATCGTGGCCCTCGTCTACAATGTGCTCAAAACATTCATGGAAATGAATTCCAAACTATTTGACGAACTCACAGCTAGCTACAAAGCAGAAAGGCAGAAAGAAAAGAAGCGCGAGAAGGAGCGCGACGAGCTGTGGAAGCGGCTGGGCGAGCTGGAGATCAGCCACAAGCGACAGCAACACGCGGCGCCGCTCGCCAAGTGA
Protein
MSSGTFVDRIDPFAKRSLKKKTKKSQGSSRYRNTQDVELQALPLLKDVPSSEQEELFIRKLRQCCVAFDFMDPVADLKGKEIKRATLNELVEYIHGGRGVLTEPVYPEIIKMISANLFRTLPPSENPDFDPEEDDPTLEASWPHLQLVYEFFLRFLESTDFQPTIGKKVIDQKFVLQLLDLFDSEDPRERDFLKTVLHRIYGKFLGLRAFIRKQINNIFLRFVYETEHFNGVGELLEILGSIINGFALPLKSEHKQFLVKVLLPLHKVKCLSLYHAQLAYCVVQFLEKDATLTEPVVRGLLKFWPKTCSQKEVMFLGEIEEILDVIEPAQFAKIQEPLFRQIAKCVSSPHFQVAERALYFWNNEYIMSLMEENNHVIMPIMFPALYRISKEHWNQTIVALVYNVLKTFMEMNSKLFDELTASYKAERQKEKKREKERDELWKRLGELEISHKRQQHAAPLAK

Summary

Similarity
Belongs to the phosphatase 2A regulatory subunit.
EMBL
BABH01029939    BABH01029940    KQ459604    KPI92290.1    NWSH01001069    PCG72797.1    + More
GAIX01004332    JAA88228.1    KQ460045    KPJ18201.1    GDQN01005131    JAT85923.1    KQ971352    KYB26642.1    GEZM01007309    JAV95252.1    GECZ01005594    JAS64175.1    GEBQ01002763    JAT37214.1    GL439621    EFN66909.1    JR050232    AEY61206.1    KK107078    QOIP01000011    EZA60452.1    RLU16633.1    DS235339    EEB14916.1    KQ978501    KYM93523.1    KQ976488    KYM83514.1    KQ978530    KYN30310.1    ADTU01019257    ADTU01019258    ADTU01019259    ADTU01019260    KQ982320    KYQ57723.1    GL888128    EGI66726.1    KQ981866    KYN34073.1    GEDC01029357    GEDC01023225    GEDC01020674    GEDC01011875    GEDC01010836    GEDC01007979    GEDC01005386    JAS07941.1    JAS14073.1    JAS16624.1    JAS25423.1    JAS26462.1    JAS29319.1    JAS31912.1    GBBI01002196    JAC16516.1    GBGD01001409    JAC87480.1    GFTR01006381    JAW10045.1    GECL01001739    JAP04385.1    KK852425    KDR24165.1    MF175170    AXF35720.1    GDRN01085051    GDRN01085050    JAI61407.1    GFDF01006551    JAV07533.1    AJWK01021007    AXCN02001161    AXCN02001162    ADMH02001517    ETN62224.1    ATLV01010762    KE524612    KFB35678.1    AAAB01008880    EAA08635.3    APCN01002592    GGFM01001189    MBW21940.1    GGFK01002662    MBW35983.1    GGFK01002445    MBW35766.1    GGFK01002451    MBW35772.1    GGFJ01003874    MBW53015.1    GGLE01006560    MBY10686.1    KQ434809    KZC06340.1    GBBK01002350    JAC22132.1    GGFM01001637    MBW22388.1    GGFM01001674    MBW22425.1    GFAA01000459    JAU02976.1    UFQS01001020    UFQT01001020    SSX08605.1    SSX28521.1    GANO01002171    JAB57700.1    GFDL01016222    JAV18823.1    GDHF01033581    GDHF01001888    JAI18733.1    JAI50426.1    GAKP01017444    GAKP01017443    GAKP01017442    GAKP01017441    JAC41509.1    GALA01001207    JAA93645.1    GBXI01016883    GBXI01014217    GBXI01004701    JAC97408.1    JAD00075.1    JAD09591.1    GBBM01000906    JAC34512.1    GFAC01005870    JAT93318.1    CH964232    EDW80866.1    IACF01000060    LAB65873.1    GDUN01000874    JAN95045.1    AXCM01002872    GDHF01024358    GDHF01010458    GDHF01001833    JAI27956.1    JAI41856.1    JAI50481.1    GAMC01009883    GAMC01009882    GAMC01009881    GAMC01009880    JAB96673.1    CH902617    EDV43887.2    KPU80522.1    KA646809    KA649640    AFP61438.1    GEFH01003327    JAP65254.1    CH954182    EDV53401.1    AF145696    AE014297    AAD38671.1    AAF56720.2    CM000160    EDW98492.1    CH933806    EDW16833.2    KRG02327.1    GFPF01011708    MAA22854.1    GANP01011620    JAB72848.1    GEDV01009082    JAP79475.1    GACK01007291    JAA57743.1    GDAI01001792    JAI15811.1    GEFM01002735    GEGO01000918    JAP73061.1    JAR94486.1    CH916373    EDV94527.1    CCAG010000730    JXJN01019901    GDAI01001793    JAI15810.1    CH940652    EDW59110.1    KRF78683.1    JRES01000501    KNC30616.1    OUUW01000005    SPP80643.1   
Pfam
PF01603   B56        + More
PF00612   IQ
Interpro
IPR016024   ARM-type_fold        + More
IPR002554   PP2A_B56       
IPR011989   ARM-like       
IPR000048   IQ_motif_EF-hand-BS       
SUPFAM
SSF48371   SSF48371       
Gene 3D
PDB
2NPP     E-value=3.10818e-150,     Score=1364

Ontologies

Topology

Length:
462
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.02509
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00345
outside
1  -  462
 
 

Population Genetic Test Statistics

Pi
261.20855
Theta
205.022916
Tajima's D
0.932414
CLR
0.008959
CSRT
0.640817959102045
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号