SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15155
Annotation
PREDICTED:_uncharacterized_protein_LOC106113369_[Papilio_xuthus]
Location in the cell
Extracellular   Reliability : 1.104 Mitochondrial   Reliability : 1.476 Nuclear   Reliability : 1.312
 

Sequence

CDS
ATGGCGGGTGCACTAGGCCGTCTTCTCCCCAATGTCGGTGGTTGCAGCGCCGGCGTCCGGCGTCTGTACCTGGGGGTCGTCCGCAGTATGGCTTTGTACGGCGCTCCCGTGTGGTCGCCCGCACTCTCTGCGCGCAATGCAGCTTTGCTGCTACGAGCGCAGCGGGTGATCGCGGTGAGGGTCATCAGGGGGTACCGTAAGATCTCCCGGGAGGTCGCCTGCGCCCTCGCCGGTTCCCTTCCTTGGGATCTCGAGGCTGAGGTAGCAGCTGCGGTATACCGGCGCAGGACACAGTCCCTGAGCCGGGGACGGACGCCCGGCCCGTCGGCTGTCGGTCGGTGGAGGCGTGCTGCGCGTCATCTGGCGTACGCCAAGTGGAGGGAGCGGTTGCTGGAGGAGCTTGGCCAAACTTCAGTCACTCGCCGACGCACCCTCGAGGCCCTGGTGCCCGTGCTGGAGGCATGGTCAGATAGACGACACGGCGTCCTCTCCTTCCACCTAACGCAGGTCCTCTCGGGGCATGGTTGCTTCGGGAGGTACCTGTGGAAGGTCTGCAGGAGAGAGCCACATCCGGGTTGCCACCAGTGTGGGCATCCGGACGATGACGCTCAGCACGCACTCGAAGCGTGCCCGCGTTGGGAGCGCTCGCGGCGAGACCTCATCGCGGTGCTGGGGAGAGACCTCTCCTTGCGGGCTGTCATCGCCCGCATGCTAGAGGACCAGAATTCTTGGGCGGCCATGACCAGGTTTTGCGACCTGGTCATGGCGTTCCGTGAGGCTGAGGAGCGCGATCCCTCTTCGGCTTCTCAGCGAAGAAGGCGGAGTGGGCGGCACGGGCGCGAAGCTCCCGTTGATCTCCCGTAG
Protein
MAGALGRLLPNVGGCSAGVRRLYLGVVRSMALYGAPVWSPALSARNAALLLRAQRVIAVRVIRGYRKISREVACALAGSLPWDLEAEVAAAVYRRRTQSLSRGRTPGPSAVGRWRRAARHLAYAKWRERLLEELGQTSVTRRRTLEALVPVLEAWSDRRHGVLSFHLTQVLSGHGCFGRYLWKVCRREPHPGCHQCGHPDDDAQHALEACPRWERSRRDLIAVLGRDLSLRAVIARMLEDQNSWAAMTRFCDLVMAFREAEERDPSSASQRRRRSGRHGREAPVDLP

Summary

EMBL
D85594    BAA19776.1    KZ150308    PZC71477.1    RSAL01000481    RVE41577.1    + More
AB126050    BAD86650.1    KZ150386    PZC71062.1    AB078935    BAC06462.1    AB078931    BAC06456.1    AB078930    BAC06454.1    KZ149950    PZC76665.1    AB090825    BAC57926.1    AB078929    BAC06452.1    LBMM01012027    KMQ86470.1    KZ149896    PZC78733.1    LBMM01008861    KMQ88580.1    ODYU01009945    SOQ54696.1    LBMM01003679    KMQ93242.1    LBMM01009494    KMQ88097.1    LBMM01014132    KMQ85305.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01006909    KMQ90209.1    QOIP01000010    RLU18098.1    QOIP01000031    RLU14697.1    LBMM01005733    KMQ91252.1    ABLF02023401    ABLF02029423    ABLF02060278    ABLF02004674    ABLF02004675    ABLF02004676    ABLF02011637    GFXV01002242    MBW14047.1    GGMR01015518    MBY28137.1    GGMR01014918    MBY27537.1    LBMM01006954    KMQ90166.1    KQ460685    KPJ12887.1    GGMR01012534    MBY25153.1    LBMM01006725    KMQ90373.1    LBMM01008349    KMQ88951.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01015018    KMQ84954.1    GALX01004785    JAB63681.1    ABLF02059310    GGMR01006977    MBY19596.1    ABLF02009991    ABLF02009992    ABLF02054952    ABLF02041886    GGMR01006838    MBY19457.1    LBMM01005216    KMQ91703.1    LBMM01019838    KMQ83439.1    ABLF02011238    LBMM01019839    KMQ83438.1    ABLF02017307    ABLF02018942    ABLF02041885    LBMM01004505    KMQ92346.1    ABLF02014530    ABLF02018586    ABLF02058000    ABLF02011183    ABLF02041884    GFXV01003903    MBW15708.1    GGMS01001211    MBY70414.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    LBMM01006110    KMQ90925.1    LBMM01012595    KMQ86127.1    LBMM01015025    KMQ84953.1    AB593322    BAK38641.1    KQ971310    KYB29500.1    KYB29499.1    LBMM01008682    KMQ88705.1    AAZX01012143    AAZX01012194    LBMM01011877    KMQ86578.1    GBHO01002982    JAG40622.1    GAPW01002043    JAC11555.1    AB593326    BAK38647.1    GGMR01005740    MBY18359.1    KQ972691    KXZ75805.1    LBMM01003245    KMQ93755.1    ABLF02016435    ABLF02016436    ABLF02064751    GGMR01011974    MBY24593.1    GGMR01011682    MBY24301.1    LBMM01002052    KMQ95336.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    QOIP01000007    RLU20280.1    LBMM01006657    KMQ90417.1    GALA01001066    JAA93786.1    ABLF02006132    LBMM01002480    KMQ94776.1    GFTR01007160    JAW09266.1    ABLF02037950   
Pfam
PF03372   Exo_endo_phos        + More
PF00078   RVT_1
PF07776   zf-AD
PF00096   zf-C2H2
PF14529   Exo_endo_phos_2
PF01553   Acyltransferase
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
287
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19619
Exp number, first 60 AAs:
0.18971
Total prob of N-in:
0.01034
outside
1  -  287
 
 

Population Genetic Test Statistics

Pi
85.663448
Theta
60.285135
Tajima's D
0.456733
CLR
1.374426
CSRT
0.506024698765062
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号