SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15140
Pre Gene Modal
BGIBMGA004923
Annotation
PREDICTED:_luciferin_4-monooxygenase-like_[Bombyx_mori]
Full name
Luciferin 4-monooxygenase      
Location in the cell
Cytoplasmic   Reliability : 3.396
 

Sequence

CDS
ATGCCCAAAGTCGTTGACATTAATACTCGACAAACATTAGGATCGTATGAACGAGGTGAAGTCTGCGTTAAAGGACCCCTGGTGATGAAAGGCTACATGAATAACGATCAAGCTAATGAAGATATAAAGGACGATGAGGGTTTCCTCAAAACTGGAGATATCGGATATTATGATTCAGACGGCTGTTTCTACATAGTCGACAGACTGAAAGAACTTATCAAATACAAAGGACATCAGGTAGCTCCAGCAATGATAGAGCGCGTACTGCTGCAGCACAGCGACGTGTTGGAGTGCGGAGTGGTGGGAGCGCCCGACGAGTTGGCTGGCGAGCTGCCCACCGCCTTCGTAGTGCCCAAGCCTGACGTCACGCTCACAGAAAGAGAACTGCTAGACTTCACTAATGAACGGTTATCCCCAATCACGCGAATACGAGGAGGTATATTCTTCGTGGGGGAAATCCCAAAGAATGCAACCGGAAAAATACTACGAAAAGTACTTAAAGCTAATTTAATAGCAAATAAATGA
Protein
MPKVVDINTRQTLGSYERGEVCVKGPLVMKGYMNNDQANEDIKDDEGFLKTGDIGYYDSDGCFYIVDRLKELIKYKGHQVAPAMIERVLLQHSDVLECGVVGAPDELAGELPTAFVVPKPDVTLTERELLDFTNERLSPITRIRGGIFFVGEIPKNATGKILRKVLKANLIANK

Summary

Description
Produces green light.
Catalytic Activity
ATP + firefly D-luciferin + O2 = AMP + CO2 + diphosphate + firefly oxyluciferin + hnu
Cofactor
Mg(2+)
Similarity
Belongs to the ATP-dependent AMP-binding enzyme family.
Keywords
ATP-binding   Luminescence   Magnesium   Metal-binding   Monooxygenase   Nucleotide-binding   Oxidoreductase   Peroxisome   Photoprotein  
Feature
chain  Luciferin 4-monooxygenase
EC Number
1.13.12.7
EMBL
BABH01029974    BABH01029976    KQ459604    KPI92264.1    ODYU01007142    SOQ49659.1    + More
KQ460045    KPJ18228.1    NWSH01001030    PCG73034.1    PCG73036.1    BABH01029979    BABH01029980    RSAL01000053    RVE50075.1    BABH01029982    KPI92263.1    AXCM01004086    ODYU01009511    SOQ54004.1    PCG73033.1    ATLV01003206    KE524124    KFB34945.1    KQ459593    KPI96566.1    RVE50074.1    KPJ18230.1    BABH01007891    JN127350    AET05796.1    AB255748    BAF34360.1    AGBW02012531    OWR44889.1    KQ460890    KPJ10988.1    AXCN02000090    JTDY01007153    KOB65430.1    ATLV01021336    KE525316    KFB46347.1    AK403861    BAM19986.1    GDIP01230533    JAI92868.1    GDIP01156704    JAJ66698.1    FJ545728    ACT68596.1    NWSH01003686    PCG65919.1    KPI96567.1    APCN01002222    GDIQ01184560    JAK67165.1    DQ137139    AAZ74651.1    GGFL01002163    MBW66341.1    GDIQ01247095    JAK04630.1    GDIP01136942    JAL66772.1    AAAB01008820    EAL41501.4    AB196455    BAE80728.1    ADMH02001657    ETN61533.1    GU062703    ADK56478.1    NEVH01013241    PNF29543.1    GGFL01000090    MBW64268.1    ADMH02001214    ETN63630.1    KPI96573.1    KK852730    KDR17523.1    GDIP01117721    JAL85993.1    LSMT01000312    PFX20569.1    GGFJ01004568    MBW53709.1    GDIP01088499    GDIP01088498    JAM15217.1    GGFJ01003984    MBW53125.1    ETN61534.1    PNF29548.1    AAAB01008961    EAA11995.3    APCN01008266    GDIP01046867    LRGB01002371    JAM56848.1    KZS08045.1    GDIQ01068764    JAN25973.1    AB220162    BAE80731.1    GDIP01075207    JAM28508.1    X66919    AB909130    BAW94791.1    AB644226    BAL46510.1    GDIP01157697    JAJ65705.1    GDIP01211436    JAJ11966.1    GGFM01004391    MBW25142.1    LJIG01009801    KRT82354.1    HACG01044107    CEK90972.1    GDIP01144886    JAJ78516.1    AF420006    AAM00429.1    GGFJ01004113    MBW53254.1    AF486800    AAN40975.1    AF486802    AF486803    AAN40977.1    GDIP01015371    JAM88344.1    AF486801    AAN40976.1    GDIQ01210454    JAK41271.1    GGFK01007825    MBW41146.1   
Pfam
PF00501   AMP-binding        + More
PF13193   AMP-binding_C
PF12017   Tnp_P_element
Interpro
IPR000873   AMP-dep_Synth/Lig        + More
IPR025110   AMP-bd_C       
IPR020845   AMP-binding_CS       
IPR042099   AMP-dep_Synthh-like_sf       
IPR027380   Luciferase-like_N_sf       
IPR021896   Transposase_37       
Gene 3D
PDB
6AC3     E-value=8.79983e-50,     Score=492

Ontologies

Topology

Subcellular location
Peroxisome  
Length:
174
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.00234
Exp number, first 60 AAs:
0
Total prob of N-in:
0.30016
outside
1  -  174
 
 

Population Genetic Test Statistics

Pi
210.948193
Theta
42.997402
Tajima's D
0.661629
CLR
0.544879
CSRT
0.566621668916554
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号