SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15112  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004905
Annotation
PREDICTED:_peroxisome_biogenesis_protein_6_[Amyelois_transitella]
Location in the cell
Cytoplasmic   Reliability : 1.78
 

Sequence

CDS
ATGTGTATCACAACATTACGTGTGACCCAACTAACTTTAGGAGAGAATATTCATGCAACAAAGCCACAAGATAAATATTTCAAGCCACAAGGATTTGATGATAATTTACACATGCTAGAACTCTGCCCAACTGGCTTAAAGCATATTTTTAATCAAATTCAAGAAACCATTTCACCATTTTTAAATGAAGATTTAAGTGACCTCTCATTGTTTTTATCGAGTCCGATTATACCAATGTTAGCCTTAACCGGCTGCTTGGGGTCTGGAAGACACTTAGCTGTAAAAACATTAGCAAAATTTAATGGAATTAATTGCCTCTCTATTGATTGCAATGCATTACAAAGCTCAACAGCTAAGCAGACTGAAAGTAAAATTAATGCAACCATACAAAAGGCAAAGGCTGCGGCACCTGTCATTGTGTTACTAGATAATTTTGAGGTATTTGCAATAGATGCAGAAAACAATGAGGACTGTAGAGTGATTGAATACTTTATGAACACAATCACTGATTTATATCAGAACTACACAAAGCACCCTATCATATTCATTGCTGTGACGAAAGATATAGAATTTAAACCGAACATAAGTAGGCTGTTTCTAGAAAAGTTTCACATACCGAAATTGAATCTTAGACAGAGATATGAGATGCTAGACTGGTTTTCCAACGTAATGAGACTAAATATAGATGGTGCAGAGCATGTGAAAGCAAATGAGTTATTAGTAAAACAAACACCAGTGAATGTAAATAGTCAGAATGTTTTACAAAGGGTGGCAGCGAAGACTGAAACGTTTTTGTATGGCGATTTGGACACATTAGTGCACTTCGCGACTAGAGAGTCGTATTTGAGGCAGCACAATAATTATAATCAACTACCGCCCGATCCTGACTTGCGGTTAATAAAGGAAGAAGATTTTAACTCGGCTTTAGAATCAATAAGAAAGCTACAAAGTCAACATTTGGACGCGCCGAAAATACCCAAAGTGTACTGGGATGATATCGGAGGGTTGGAGAAACTAAAAAAGGAATTACTTAAGACAATACAGCTTCCTATTAAATACCCACACTTGTTCAAAAACGCGAGCCTCAAAAGATCAGGCATACTGTTGTACGGGCCTCCAGGTTGTGGGAAAACGTTAGTAGCTAAAGCAGTAAGCACGGAGTTGAATGTGAGCTTTCTCAGTGTCAAAGGTCCCGAGCTACTAAATATGTACATCGGTCAGTCCGAAGAGAATGTTAGAAAAGTCTTCGAGTCTGCACGCGCATCGTCTCCGTGCATAATATTCGTGGACGAGCTGGACGCGCTGGCGCCGCGCCGCGGGGCCGCCGGGGACTCCGCCGGCGCCAGCGACCGCGTCGTCAGCCAACTGCTCGCTGAACTCGACGGGGTCAATACCTCGGGAGATGAAGACACGTCCAGCTTCGTGTTCATAATGGGCGCAACGAACCGGCCCGATTTACTCGAACAATCTCTGCTGCGGCCCGGTAGACTCGATAAGCTCGTCTACGTGGGGCCCTACTGTGGGACGCGAGAGAAGACATCAGTGCTCGAAGCGCTTTGTCGGAAGTACAAACTAAGACCTGAAGTAAATTTGGAAGCCGTCGCAGAGGCACTACCCGACAAGTGCACCGGCGCTGACTTACTGCAGGTTGTCTCTACTGCACGGTCAGCGGCCGTGAGAGCACTCGTTGCTAAGCTACACAATGGAACGTTAAAGGAAAGCGAACTGAGTCCCGACTCCATCGTTATAGGGGTAACTGAACTATGGGAGGGCGTTGTATCATTCCGGCCCTCGGTCACAGACGATGAACTGTCGCATTACGAAGCGATGGAGTCACAAATCAACAGAGACGCCATAGAAAAGGAATTTCAGTTCAAAAATTTTAATGAAGCTTTTGGATTCATGACCAGGGTCGCGCTGCTAGCTGAGAAAATGGATCATCATCCTGAGTGGTTCAATGTATACAACAAGTTGCAAGTGACACTTTCTTCACATGACGTAAATGGATTGAGCAAAAGGGATATCAAAATGGCCAGTTTTATGGATAAAAATTATAATTAA
Protein
MCITTLRVTQLTLGENIHATKPQDKYFKPQGFDDNLHMLELCPTGLKHIFNQIQETISPFLNEDLSDLSLFLSSPIIPMLALTGCLGSGRHLAVKTLAKFNGINCLSIDCNALQSSTAKQTESKINATIQKAKAAAPVIVLLDNFEVFAIDAENNEDCRVIEYFMNTITDLYQNYTKHPIIFIAVTKDIEFKPNISRLFLEKFHIPKLNLRQRYEMLDWFSNVMRLNIDGAEHVKANELLVKQTPVNVNSQNVLQRVAAKTETFLYGDLDTLVHFATRESYLRQHNNYNQLPPDPDLRLIKEEDFNSALESIRKLQSQHLDAPKIPKVYWDDIGGLEKLKKELLKTIQLPIKYPHLFKNASLKRSGILLYGPPGCGKTLVAKAVSTELNVSFLSVKGPELLNMYIGQSEENVRKVFESARASSPCIIFVDELDALAPRRGAAGDSAGASDRVVSQLLAELDGVNTSGDEDTSSFVFIMGATNRPDLLEQSLLRPGRLDKLVYVGPYCGTREKTSVLEALCRKYKLRPEVNLEAVAEALPDKCTGADLLQVVSTARSAAVRALVAKLHNGTLKESELSPDSIVIGVTELWEGVVSFRPSVTDDELSHYEAMESQINRDAIEKEFQFKNFNEAFGFMTRVALLAEKMDHHPEWFNVYNKLQVTLSSHDVNGLSKRDIKMASFMDKNYN

Summary

Similarity
Belongs to the AAA ATPase family.
EMBL
ODYU01007835    SOQ50948.1    KQ459604    KPI92239.1    KQ460045    KPJ18255.1    + More
AGBW02007949    OWR54399.1    JTDY01003307    KOB69766.1    CM000362    EDX06551.1    CM002911    KMY92880.1    KMY92881.1    KMY92882.1    NEVH01025150    PNF15634.1    JRES01001601    KNC21562.1    CH480816    EDW47322.1    CH954179    EDV56555.1    KQS62900.1    AY058375    AE013599    AAL13604.1    ACZ94389.1    AAF58736.4    CM000071    EDY69249.1    CH479223    EDW35005.1    CM000158    EDW90065.1    PNF15633.1    KRJ98885.1    CH902619    EDV38095.1    KPU77274.1    OUUW01000001    SPP75750.1    SPP75749.1    CCAG010023102    AJVK01012215    AJVK01012216    KA645619    AFP60248.1    CH963846    EDW72558.1    GBXI01005243    JAD09049.1    GAMC01011943    GAMC01011939    GAMC01011938    JAB94616.1    GBXI01017495    JAC96796.1    GBXI01006223    GBXI01003716    JAD08069.1    JAD10576.1    GAMC01011941    GAMC01011935    JAB94614.1    CH940648    EDW61018.2    GDHF01011335    JAI40979.1    GFDF01004201    JAV09883.1    GDHF01031927    GDHF01030711    GDHF01009755    JAI20387.1    JAI21603.1    JAI42559.1    GDHF01018008    JAI34306.1    CH933808    EDW09954.1    KRG05006.1    ATLV01019994    KE525289    KFB44754.1    CH916367    EDW00978.1    CH477196    EAT48385.1    AJWK01015551    AJWK01015552    CP012524    ALC42753.1    GFDF01004117    JAV09967.1    GEZM01009837    JAV94276.1    JXUM01037600    JXUM01037601    JXUM01037602    KQ561134    KXJ79611.1    APCN01000890    AAAB01008987    EAA00892.4    GBYB01007209    GBYB01008900    JAG76976.1    JAG78667.1    KQ971326    EEZ99865.1    KZ288203    PBC33392.1    KQ414617    KOC68156.1    GGFK01008682    MBW42003.1    AXCN02000266    KQ434977    KZC12881.1    ADMH02002183    ETN57979.1    DS231954    EDS28849.1    APGK01030336    KB740770    ENN78988.1    GL437329    EFN70620.1    NNAY01000305    OXU29339.1    GDIQ01072746    JAN21991.1    GL453666    EFN75694.1    GDIQ01110532    JAL41194.1    GDIQ01007478    JAN87259.1    GDIP01098377    JAM05338.1    KQ435793    KOX74203.1    GDIP01142927    JAL60787.1    LRGB01002190    KZS08580.1    GL888261    EGI63723.1    ADTU01016871    GDIP01008481    JAM95234.1    JH818807    EKC26023.1    GDIP01083289    JAM20426.1    AHAT01027972    KQ976513    KYM82398.1   
Pfam
PF03297   Ribosomal_S25        + More
PF00004   AAA
PF17862   AAA_lid_3
PF00288   GHMP_kinases_N
PF18376   MDD_C
PF09336   Vps4_C
Interpro
IPR003593   AAA+_ATPase        + More
IPR004977   Ribosomal_S25       
IPR003959   ATPase_AAA_core       
IPR027417   P-loop_NTPase       
IPR003960   ATPase_AAA_CS       
IPR041569   AAA_lid_3       
IPR020568   Ribosomal_S5_D2-typ_fold       
IPR029765   Mev_diP_decarb       
IPR041431   Mvd1_C       
IPR036554   GHMP_kinase_C_sf       
IPR006204   GHMP_kinase_N_dom       
IPR014721   Ribosomal_S5_D2-typ_fold_subgr       
IPR015415   Vps4_C       
SUPFAM
SSF52540   SSF52540        + More
SSF54211   SSF54211       
SSF55060   SSF55060       
Gene 3D
PDB
5VCA     E-value=5.82674e-56,     Score=553

Ontologies

Topology

Length:
686
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.790629999999998
Exp number, first 60 AAs:
0.00013
Total prob of N-in:
0.03635
outside
1  -  686
 
 

Population Genetic Test Statistics

Pi
262.134966
Theta
186.325877
Tajima's D
2.484172
CLR
0.327259
CSRT
0.942802859857007
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号