SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15101  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004898
Annotation
PREDICTED:_dolichyl-diphosphooligosaccharide--protein_glycosyltransferase_subunit_STT3B_isoform_X1_[Bombyx_mori]
Location in the cell
PlasmaMembrane   Reliability : 4.933
 

Sequence

CDS
ATGCCGTCCACTACTGAGACCCTTCCCAGTAATGGGCGCAGCAAGGGGCTATTTCAAAATACGGCGGGTTTGAGTACGCTCATCACTGTAACTGTCCTGACACTGGCTTGGTTGGCCGGTTTCGCATCCCGGCTTTTCGCTGTGATACGTTTTGAAAGTATAATTCATGAATTCGATCCTTGGTTCAACTACCGGTCTACAGCGTATATGGTTCAGCACGGTTTCTATAATTTTTTGAACTGGTTCGATGAGCGTGCTTGGTACCCACTGGGACGTATCGTGGGGGGTACGGTGTATCCTGGTCTAATGATCACTTCAGGCACTATACATTGGATACTGCATGCTCTCAACATACCCATTCATATCCGAGACATATGTGTATTCCTTGCCCCAGTATTCAGTGGGCTCACAGCAATTGCAACGTACTTATTGACTTCTGAACTATGGTCGCGTGGAGCTGGGCTATTTGCTGCCTGTTTCATAGCTATAGTGCCAGGTTACAGCAGTAGATCCGTTGCTGGGAGCTACGATAATGAAGGAATTGCTATATTTGCATTGCAATTCACATATTACTTGTGGCTGAAAAGTGTTAAAAGTGGGTCCGTATTCTGGTCTATTTGCACTGCATTGTCATATTTTTACATGGTTTCAGCATGGGGCGGATACGTATTCATTATCAATTTGATACCTCTTCACGTCTTTGTTCTTCTAATAATGGGACGTTTCTCGCAGCGTCTTTTCGTCAGCTACTCAGTTTTCTACATTATTGGCTTATTGCTGTCCATGCAGATTCCCTTTGTTGGGTTTCAACCAATACGTACCAGTGAACATATGGCAGCGTCAGGTGTGTTTGCATTGTTGATGGCCATCGGAGCCCTAAAGTACCTGCACAGTCTGAACCCTAAAGGACAATGGAAACAACTGCTAATCTTGGGCGGTATGCTGGCCGCGGGACTCGTGTTCCTGGCTGTGGTGCTCCTCACATACATGGGAGTCATTGCACCTTGGAGTGGAAGGTTTTATTCACTCTGGGACACGGCATACGCAAAGATTCACATTCCGATCATAGCGTCCGTATCCGAGCACCAGCCGACGACGTGGTCTTCATTTTTCTTCGATCTGCACGTGCTCGTGTGCACGTTCCCGGTCGGTCTGTGGTACTGCATCAAGAATGTGAATGATGAGAGAGTTTTCGTTGCTCTGTATGCCCTGAGTGCGGTGTATTTCGCCGGTGTGATGGTTCGTTTGATGTTGACCCTGACGCCCGTAGTGTGCGTGCTAGCCGGCATTGCCTTTTCCATTCTTCTAGACTTGGCCTTAAGAGAGGACGAAGTGCCTGAACAATCCCCGGACAGTGAAGAATCTAAGAGTCTCTATGATAAAGCCGGCAAGGTAAAGAAGCGCACACTTGAGGCCGCGCCGAATGCGGACACCGGCCTGGGCATGAACGTGCGCTCGGGAACGCTCATAGCCTTCATGATCCTGCTGATGTTGTTCTCTGTGCACTGCACCTGGGCCACGTCTAACGCTTACTCCAGCCCTAGCATCGTTCTGGCCAGCTACGGCAATGACGGGTCGCGTAAAATCTTAGATGACTTCCGAGAAGCCTACGGTTGGTTATCGCAGAATACAGCAGAAGACGCAAGGATTATGTCTTGGTGGGACTACGGGTATCAGATAGCGGGGATGGGTAACAGAACAACCCTGGTGGACAATAACACCTGGAACAACTCCCACATAGCACTGGTCGGGAAGGCGATGGCGAGCAACGAATCCGCTGCCTACAGCATCATGACGATGCTGGACGTTGATTACGTGCTCGTTATATTCGGGGGCGCGATCGGGTACTCCGGAGACGACATCAACAAGTTCATATGGATGGTCAGGATCGCTGAGGGGGAACATCCTAAGGACATACACGAAGTTGACTATTTTACTGAAAGAGGAGAATACAGGATCGACTCTGAAGGATCAAAAACTATGTTGAACTGTTTGATGTACAAACTCTCGTATTATAGGTACGACAGTGGGGGAAGCCCTCCCGGGTACGACCGTACGCGCAGTGCGCTGCCCGGGAACAGAGGGTTCAAACTTACCTACCTCGAGGAAGCCTACACCACCGAGCACTGGCTCGTCAGGATATACAGGGTGAAAAAGCCATCTGAGTTCAATCGTCCGCGTTTGTCACTAGCAAAAAGGAAAATTTCAACAAGCAATACTATTTCTAAGAAGACTTCAAGAAGAAGAAAAGGCGCATTGAAGAACAAACCTACAGTCGTGAAGGGAAAAAAGGTCGGTAAACTGGAGTGA
Protein
MPSTTETLPSNGRSKGLFQNTAGLSTLITVTVLTLAWLAGFASRLFAVIRFESIIHEFDPWFNYRSTAYMVQHGFYNFLNWFDERAWYPLGRIVGGTVYPGLMITSGTIHWILHALNIPIHIRDICVFLAPVFSGLTAIATYLLTSELWSRGAGLFAACFIAIVPGYSSRSVAGSYDNEGIAIFALQFTYYLWLKSVKSGSVFWSICTALSYFYMVSAWGGYVFIINLIPLHVFVLLIMGRFSQRLFVSYSVFYIIGLLLSMQIPFVGFQPIRTSEHMAASGVFALLMAIGALKYLHSLNPKGQWKQLLILGGMLAAGLVFLAVVLLTYMGVIAPWSGRFYSLWDTAYAKIHIPIIASVSEHQPTTWSSFFFDLHVLVCTFPVGLWYCIKNVNDERVFVALYALSAVYFAGVMVRLMLTLTPVVCVLAGIAFSILLDLALREDEVPEQSPDSEESKSLYDKAGKVKKRTLEAAPNADTGLGMNVRSGTLIAFMILLMLFSVHCTWATSNAYSSPSIVLASYGNDGSRKILDDFREAYGWLSQNTAEDARIMSWWDYGYQIAGMGNRTTLVDNNTWNNSHIALVGKAMASNESAAYSIMTMLDVDYVLVIFGGAIGYSGDDINKFIWMVRIAEGEHPKDIHEVDYFTERGEYRIDSEGSKTMLNCLMYKLSYYRYDSGGSPPGYDRTRSALPGNRGFKLTYLEEAYTTEHWLVRIYRVKKPSEFNRPRLSLAKRKISTSNTISKKTSRRRKGALKNKPTVVKGKKVGKLE

Summary

EMBL
BABH01030048    RSAL01000006    RVE54323.1    KQ460045    KPJ18264.1    KQ459604    + More
KPI92228.1    AGBW02012127    OWR45595.1    KQ971352    EFA06314.1    GEDC01027272    JAS10026.1    GEDC01004622    JAS32676.1    KT362368    ALL54974.1    GECZ01028593    GECZ01023734    GECZ01021305    GECZ01019067    GECZ01018073    GECZ01011846    GECZ01008984    JAS41176.1    JAS46035.1    JAS48464.1    JAS50702.1    JAS51696.1    JAS57923.1    JAS60785.1    GEBQ01017296    JAT22681.1    GEZM01080230    JAV62283.1    ACPB03016273    UFQT01000309    SSX23079.1    GBYB01002990    JAG72757.1    ATLV01019399    KE525269    KFB44137.1    KA646561    AFP61190.1    GL448096    EFN85392.1    GAMC01004143    JAC02413.1    GFDL01010692    JAV24353.1    CVRI01000006    CRK87989.1    KK107405    QOIP01000014    EZA51220.1    RLU14762.1    JXUM01094529    JXUM01094530    JXUM01094531    JXUM01094532    JXUM01094533    JXUM01094534    JXUM01094535    KQ564135    KXJ72708.1    GDRN01088576    JAI60832.1    GDRN01088577    JAI60831.1    CH954182    EDV53749.1    GFDF01001582    JAV12502.1    GALA01001242    JAA93610.1    CH477253    EAT45977.1    GBHO01014888    GBHO01014886    JAG28716.1    JAG28718.1    NEVH01006756    PNF36504.1    KK853153    KDR10570.1    AE014297    AAF56391.1    DS232010    EDS31617.1    CM000160    EDW98832.1    GDHF01001165    JAI51149.1    AF132552    AAD27851.2    GL439266    EFN67572.1    CH902617    EDV42245.1    CH480848    EDW51142.1    JRES01000595    KNC29985.1    CH916369    EDV93909.1    DS235804    EEB17292.1    AXCN02000218    GL732529    EFX86763.1    AAAB01008859    EAA08102.4    CH940650    EDW66480.1    GANO01002714    JAB57157.1    APCN01000421    AXCM01010392    CH933806    EDW13627.1    CH964272    EDW83951.1    ADMH02002130    ETN58574.1    CCAG010012076    ADTU01011776    GGFM01005990    MBW26741.1    GGFK01000679    MBW34000.1    GGFJ01002319    MBW51460.1    AJWK01005824    JXJN01025262    OUUW01000007    SPP83247.1    CH479182    EDW33866.1    CH672826    EDY71890.1    JR046220    AEY60155.1    GL888912    EGI57383.1    CP012526    ALC47917.1    KZ288194    PBC33809.1    NNAY01000155    OXU30479.1    IACF01002106    LAB67774.1    JH431734    GFTR01007873    JAW08553.1    GFXV01006812    MBW18617.1    GGMS01005275    MBY74478.1    ABLF02016087    GFWZ01000137    MBW20127.1    GFWV01008362    MAA33091.1    KQ414894    KOC59692.1    GGLE01000977    MBY05103.1    LBMM01003343    KMQ93634.1    GFJQ02007922    JAV99047.1    GL771864    EFZ09359.1   
Pfam
PF02516   STT3        + More
PF00710   Asparaginase
PF12796   Ank_2
PF17763   Asparaginase_C
PF16003   DUF4776
PF00293   NUDIX
Interpro
IPR003674   Oligo_trans_STT3        + More
IPR002110   Ankyrin_rpt       
IPR027475   Asparaginase/glutaminase_AS2       
IPR006033   AsnA_fam       
IPR041725   L-asparaginase_I       
IPR040919   Asparaginase_C       
IPR027473   L-asparaginase_C       
IPR027474   L-asparaginase_N       
IPR037152   L-asparaginase_N_sf       
IPR036152   Asp/glu_Ase-like_sf       
IPR020683   Ankyrin_rpt-contain_dom       
IPR006034   Asparaginase/glutaminase-like       
IPR036770   Ankyrin_rpt-contain_sf       
IPR031949   DUF4776       
IPR000086   NUDIX_hydrolase_dom       
IPR011876   IsopentenylPP_isomerase_typ1       
IPR015797   NUDIX_hydrolase-like_dom_sf       
SUPFAM
SSF48403   SSF48403        + More
SSF53774   SSF53774       
SSF55811   SSF55811       
Gene 3D
PDB
6FTI     E-value=0,     Score=2011

Ontologies

Topology

Length:
769
Number of predicted TMHs:
13
Exp number of AAs in TMHs:
285.696109999999
Exp number, first 60 AAs:
22.14802
Total prob of N-in:
0.73231
POSSIBLE N-term signal
sequence
inside
1  -  20
TMhelix
21  -  43
outside
44  -  90
TMhelix
91  -  113
inside
114  -  124
TMhelix
125  -  144
outside
145  -  147
TMhelix
148  -  170
inside
171  -  190
TMhelix
191  -  213
outside
214  -  217
TMhelix
218  -  240
inside
241  -  246
TMhelix
247  -  269
outside
270  -  278
TMhelix
279  -  296
inside
297  -  307
TMhelix
308  -  330
outside
331  -  366
TMhelix
367  -  389
inside
390  -  395
TMhelix
396  -  414
outside
415  -  417
TMhelix
418  -  440
inside
441  -  485
TMhelix
486  -  508
outside
509  -  769
 
 

Population Genetic Test Statistics

Pi
288.752573
Theta
205.669301
Tajima's D
0.665528
CLR
0.66621
CSRT
0.565521723913804
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号