SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15088
Pre Gene Modal
BGIBMGA014080
Annotation
PREDICTED:_autophagy-related_protein_2_homolog_A-like_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.688 Nuclear   Reliability : 1.663
 

Sequence

CDS
ATGGCCTATATATCGCGCATCCCCCGTGCTGTCATCCGCATAGCAATGCATGCCATCGATAGACAGCATGTCATTGATATACAGGATGAAAAGCGTGGGGGAGAGCACCGAACCTTGTGGAACGCCAGCGTTAATGATCATCGTATAAGAACAGGCACCGTCTACAACGACCGTGATGTTCCGCCCATCCAAAAAGCTAGCGATCCACTTGCAGAGACCCTCGGGGATTCCGTAAGATGGGTCCTGACGTCTCCTGGCATCAACCCATGCCGCGTATGCGGACCGCTTAAGGTGTGCAGCATCCCTACTGACATTGTTATACCAGGGTCTGCCGCGACCCCCAACGGGCACCTCAGAGGAGAGAATAAACAATTCCATCCCCTGGAGCACTACGTCATTAAGACGGTCCGCACAGACGTCAGGATCGGTAGAGGAAAAGCAGAACCGTCCCCATGGGTTAAATCCGGCGGCGATGGGAGCAACACCGACGACGAATACTGTTTCGTGGAGACCCAACCCAGCAGTCAGGACAACGATCTGGATGAGCCAGTCGTGAACTGGATCGGTTCAGGGCCGGCCTACATGTTCGACAATCACTTCAGCGTTCCCGCTGCTAGGACTGATGTACTTAAAGCACCGAAGAGTTTCCCATTGCCGATGTTGCGGTACACGTTGTGCGAAATGAGCATCACATGGAACATGTACGGGGGCAATGACTTCCGTAATCCCGCCGACGCGGTATCTTCCAAGAAAACGGTCACCATAGATGACAATCGTAAATTAGGATCCCCTACCTCTGTAAAGCGCAGTAAAGACTACGAGCCGTACGAGAGCGGCCGCGCCATTGCAGCCGCGTACAGAAGCGGCGGGGTCGGCTGGGCGGCGGGCGCCGACCGAGTGCGGACCAACACGCGCGCGAGCGTGAAGCGCAGGGAACTACGCACCAGGGGCGGACCTCAACGCGACCACAAGACGAAGGTCAAACTCTGCCTCACTAAAGTGAAATTCCAATACGAGGTGTATCCTTCTGGTGGCATGCACGCGTCCCGGCAAACCCTCGCGATCAGCAAGATCGAAGTATTGGATCAACTTGAGTGCAGCGACATCAACAAGCTTCTCAGCCAGTACAAGTTGAAAGACGAGCCGGAGAGAAAAAACGCCCATATGTTAGTTGTGAAAGCAGTACACCTGCGTCCAGACCCCGCACTGACGGCCCAGGAGTGCTGCCTCAAGATATCTCTGTTGCCGCTCTGGTTCAACCTCGACCAAGACACGTTGGGCTTCTTGGTGGGATACTTTTCTAAATTAGGGTCTGATGAATGCAGCGGTGAAGACGACTCAAAAAGCGTCGGAGGTCTGTCGACGGACTCTAGCGGGTCGAGACAGACCACGCCCACCCACCGGCCCCCCGTCATGACCATCGCGAGCCACCTCAAGGACCCGCCCCCCACCCCCACCTCGCTGGGGGACGCTGATGCCCTATCGCTCAACGAAACTGTGCTTCGCGATGAAGAGCCTCTAATGGAGACGTACGAAGCGGAGCGTCTGGTCTCCGAGAACCTGATCCAGCTCGAGGAAGACTTCAACAAACTGGGCATCGATCAAGGGAAACCGGCCGCGAAGCTACCCGTCGACGCTGAGCCCGTCGACGACTCACCGATTTACTTCAGACGCGTGGTGTTTTCCCCGGAAGTACCCATACGATTGGACTACGTGGGCAAACGCGTGGACCTGTCGTCTGGTCCGGTCGCTGGCCTGCTCATGGGACTTGGGCAACTCAACTGCTCCGAGCTCACACTGAAGAGGCTTGACTACAAACTTGGATTGTTGGGCACTGAGAAACTAGTTCAGTGGGCGTTGCACGAATGGCTCTCCGACATAAAGAGGCATCAACTACCGGGATTGCTCAGTGGAATAGGACCGATGCACTCGCTTTTACAACTCATAACCGGCATCCGCGACCTCGTGTGGCTGCCGGTGGAGCAGTGGCGGCGCGACGGGCGGCTGGTGCACGGGCTGCGGCGCGGCGCGGCCTCCTTCACGGCGCGCACTGCCGTCGCCGCGCTCGATATCACCACGCGCATCCTGCACCTCATACAGGCCACAGCAGAGACAGCATTCGACATGCTGACCCCCGGGCCGACCCTGCAGCTGCAAGACGCGTACAACCGCCGGGAGAGGCGTCGCCGGCGGCGGCTGGACCCCTCGCGTCACCCTACCGACATCAGAGACGGAGTGGCCAGCGCCTATCAAACAGTCCGAGAGGGCTTCGCGGAGACAGCGGCGACGGTGAGTCTGGCGGCGCGCGAGTCTAGCGGCGTGGGCGTGCTGCGCATGCTGCCCGGCGCCGCGGTGTCGCCGCTGCTGCTGGCGGCCGCGGGCGCCGCCGACCTGCTGGGCGGGGTGCGCGCCACGCTGGCGCCGCACGAGCGGGGACACTGCGCCGACAAGTGGCGCCGCCACCCTACTCCGGACGCCGTGGACGATTGA
Protein
MAYISRIPRAVIRIAMHAIDRQHVIDIQDEKRGGEHRTLWNASVNDHRIRTGTVYNDRDVPPIQKASDPLAETLGDSVRWVLTSPGINPCRVCGPLKVCSIPTDIVIPGSAATPNGHLRGENKQFHPLEHYVIKTVRTDVRIGRGKAEPSPWVKSGGDGSNTDDEYCFVETQPSSQDNDLDEPVVNWIGSGPAYMFDNHFSVPAARTDVLKAPKSFPLPMLRYTLCEMSITWNMYGGNDFRNPADAVSSKKTVTIDDNRKLGSPTSVKRSKDYEPYESGRAIAAAYRSGGVGWAAGADRVRTNTRASVKRRELRTRGGPQRDHKTKVKLCLTKVKFQYEVYPSGGMHASRQTLAISKIEVLDQLECSDINKLLSQYKLKDEPERKNAHMLVVKAVHLRPDPALTAQECCLKISLLPLWFNLDQDTLGFLVGYFSKLGSDECSGEDDSKSVGGLSTDSSGSRQTTPTHRPPVMTIASHLKDPPPTPTSLGDADALSLNETVLRDEEPLMETYEAERLVSENLIQLEEDFNKLGIDQGKPAAKLPVDAEPVDDSPIYFRRVVFSPEVPIRLDYVGKRVDLSSGPVAGLLMGLGQLNCSELTLKRLDYKLGLLGTEKLVQWALHEWLSDIKRHQLPGLLSGIGPMHSLLQLITGIRDLVWLPVEQWRRDGRLVHGLRRGAASFTARTAVAALDITTRILHLIQATAETAFDMLTPGPTLQLQDAYNRRERRRRRRLDPSRHPTDIRDGVASAYQTVREGFAETAATVSLAARESSGVGVLRMLPGAAVSPLLLAAAGAADLLGGVRATLAPHERGHCADKWRRHPTPDAVDD

Summary

EMBL
GDQN01008634    JAT82420.1    KQ459604    KPI92217.1    AGBW02013098    OWR43991.1    + More
ODYU01006127    SOQ47706.1    GEZM01043182    JAV79247.1    GEZM01043181    JAV79248.1    KQ971354    KYB26227.1    JXUM01078091    KQ563044    KXJ74581.1    EFA07398.2    JXUM01064717    KQ562311    KXJ76186.1    KQ414667    KOC64737.1    AXCM01002419    KZ288194    PBC33937.1    CH477282    EAT44885.1    AAAB01008880    EAA08640.5    NEVH01020340    PNF21609.1    APCN01002595    APCN01002596    PNF21608.1    UFQS01000189    UFQT01000189    SSX00997.1    SSX21377.1    ADMH02002196    ETN57873.1    LJIG01016265    KRT81120.1    DS232402    EDS41201.1    AXCN02001163    GGFK01000646    MBW33967.1    NNAY01003012    OXU20123.1    GGFK01000493    MBW33814.1    GGFJ01000043    MBW49184.1    GFDL01002607    JAV32438.1    GFDL01002599    JAV32446.1    KQ435863    KOX70359.1    KK107405    EZA51215.1    GFDL01003706    JAV31339.1    GFDL01003708    JAV31337.1    QOIP01000014    RLU14943.1    ATLV01010765    KE524612    KFB35685.1    GL447336    EFN86545.1    GFDF01003674    JAV10410.1    GFDF01003673    JAV10411.1    KQ434809    KZC06215.1    GL442637    EFN63197.1    GDHC01019672    JAP98956.1    GBHO01018318    JAG25286.1    KB632233    ERL90415.1    APGK01057870    KB741282    ENN70837.1    KQ979079    KYN22683.1    CVRI01000059    CRL03003.1    GEDC01015740    JAS21558.1    KQ982730    KYQ51543.1    KQ981667    KYN38464.1    GFTR01008928    JAW07498.1    KQ976394    KYM93249.1    ADTU01017115    ADTU01017116    GL888087    EGI67715.1    KQ978068    KYM97612.1    LBMM01002400    KMQ94872.1    GGMS01016983    MBY86186.1    DS235339    EEB14915.1    GDIQ01081173    JAN13564.1    GDIQ01068336    JAN26401.1    JRES01000902    KNC27438.1    LRGB01001800    KZS10430.1    GFWV01023164    MAA47891.1    AJWK01029397    AJWK01029398    AJWK01029399    GDIQ01101218    JAL50508.1    GDIQ01034443    JAN60294.1    GDIQ01005267    JAN89470.1    GDIP01073634    JAM30081.1    GDIP01020857    JAM82858.1    KA646800    AFP61429.1    LNIX01000025    OXA42667.1    ABLF02012006    QCYY01002618    ROT68945.1    GFXV01001381    MBW13186.1    CYRY02042655    VCX36440.1   
Pfam
PF09333   ATG_C        + More
PF12624   Chorein_N
PF16909   VPS13_C
PF13329   ATG2_CAD
Interpro
IPR026849   ATG2        + More
IPR015412   Autophagy-rel_C       
IPR026854   VPS13_N       
IPR026885   ATG2_CAD_motif       
IPR031645   VPS13_C       

Ontologies

Topology

Length:
829
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.98174
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00020
outside
1  -  829
 
 

Population Genetic Test Statistics

Pi
3.743288
Theta
171.464621
Tajima's D
1.339427
CLR
0.294404
CSRT
0.749862506874656
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号