SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15082
Annotation
unnamed_protein_product_[Drosophila_melanogaster]
Full name
RNA-directed DNA polymerase from mobile element jockey       + More
Probable RNA-directed DNA polymerase from transposon BS      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 2.795
 

Sequence

CDS
ATGACTGCACTAAAAATAGCTACATGGAACATCAATGGCTTGGCACCCAACATCGATGAAGTGGAAATTCTGATCTGTCTACATAGTCTAGACATTCTCCTAATTTCAGAGACACATATGACGACCAGCAGCTCGATAAGAATTAAAGGATATAAGATCTATTCCACAAATCACCCAGACGGTACAGCCCACGGCGGGACAGCAGTGATAATCAAAGCCACTGTTAGACACCATGTGCTACCAAACTACTGTACCGAACATATCCAGGCTACCACAGTAGCAGTCAGTGACAGAAATGGAGACTTTAATATATCATCAATTTATTGTCCCCCGAAACATAAAATAAGTGAAGCACAGTTTTCTGACTACTTTTTAAGCTTAGGATACAGATTTATTGCTGGGGGTGACTGGAATGCGAAGCATTCGCACTGGGGCTCTAGATTAATAACTACACGTGGAAGGGAGCTGAAGAAAAGTGTAGATAAACAGTTCTTGACTACTGTGTCAACTCCAGAACCAACACACTGGCCCACAGACCAGAACAGACTGCCAGACGTTCTAGACTTTTTCATCACAACAGGACTGTCTCGACTGTTCTTCAATGTTGAGTCATGCCTCGATAGCTCATCTAACCATATTCCTGTAATATTGACAGTGAGCACCACTATTCTTAAGAAAGAAGTTCGGCAAACATTGTACAACAAATACACAGACTGGGATAGCTTCCGGGAAATAGTTGATACGAAGCTAAGCCTAAAAATAGCACTTAAAACAGAAGAGGATATCGAAGAAGCCACAAAGCATTTCACCACAACAGTTCAAGCTGCCTGCTGGAAAACCTCTCCGGAGCACTTGAATCCCAGGCCACGGCAAAATAAGATATCGTTTGAAATAAAAGAACTGATTCTGAACAAAAGAAAACTGCGAAGAAATAACACTTGGGCAAGAACAAGAAAAGAAAAAGCTGACGCCTTTGCTGTTCACTTAGCAAAAGTATTCACGCCTAATGATGCTGACCCAAACACTGATGATTCCTTCATAGATTCGGCCCTAAGTCAAGACTTCCAGCTCGATTTGCCGATTAGGCCTACAACTCCGAAAGAAGTCGTGGCAACAATCTCAAAATTGGAGGACAAAAAAGCCCCCGGGTTTGATTTAATAGACAAAAAAGTCTTGAAGGAACTTCCCAAAAAAGCCATAGTTTTTCTAACCATCTTATTTAATGGCATACTAAGAACTGGACACTTTCCATCACTGTGGAGAGTTTCACAAGTAATTATGATACCTAAAGTAGGGAAGCCAGTGAACGAACTTAGCTCATACAGGCCGATTAGTCTACTAACCGTAACGTCAAAACTTTTTGAGTCAGTCCTGCTGCACAGATTATTGGAGGAGATTCATCAAAGAGCCATAATCCCGGACCACCAGTTTGGCTTTCGCCAGCAGCATGGCACTGTGGAACAAGTCCATAGAATCTGCTCTGTGATAAGGAAGGCACTAGAGAGAAAGGAGTACTGCTCCTCTGCCTTCCTAGACGTGCAGCAAGCGTTTGATAGAGTATGGCACAAAGGTCTCTTGTATAAAGTAAAAACTCTTCTACCCTGTACATTCTTCCCCATCATAAAATCTTATCTAACAGAAAGAATATTTCAAATAAGAGAAGAAGAGTGTACATCGCCATTTCACTCAATCAAAGCTGGTGTACCGCAGGGGTCTGTCCTGGGTCCAGTCTTGTATACCATTTACACATGTGATTTACCACAAAGCGAACATGTTACATTAGCAACATTCGCAGACGATACCGCTGTACTGGCATGTAGCAATTGCCCAAACGAAGCTTCAGACTTCCTACAGACTGGATTGCAAGAAATTGAAACTTGGCTTTCAAAGTGGAGAATAAAAACTAGTGTGACAAAATCCGTTCATGTAACCTTCACCCTCCGTAGAGGAGACTGTCCGCCAGTAACTCTGTGCAATCAACAACTCCCGCAAGAACACTGCGTAAAATACTTGGGAATACACCTTGATAGGAGACTCGTATGGAAACAACACATACAGAAGAAGAGAGAAGAAATCAACCTGAAATACAGAGGACTCTACTGGCTGCTTGGCAGAAATTCCAAGCTGTCAGTAGATAATAAGCTACTCATCTACGAAATGCTCTTGAAACCAATTTGGACATACGGGATTCAACTATGGGGTTCGGCGTGTGACTCTAACATAAATATCATACAGAGGGTTCAAAATTACATCCTGAAACAAATATCGAACTGTCCGTGGTTTATAAAAACATCGGAGATTCATGAACACCTCAAAATCAGGACTGTTAAACAGGAAATCAAGACCTGGAGTATGAAATACAGAAAAAGGCTAGAAATGCATCCTAATAAGCTTGCCACGCAACTAACCACACCGGACCTAATAAATAGGCTTAAAAGGCGACAAATCCTAAGTCTTGATAGAAACGGTTGA
Protein
MTALKIATWNINGLAPNIDEVEILICLHSLDILLISETHMTTSSSIRIKGYKIYSTNHPDGTAHGGTAVIIKATVRHHVLPNYCTEHIQATTVAVSDRNGDFNISSIYCPPKHKISEAQFSDYFLSLGYRFIAGGDWNAKHSHWGSRLITTRGRELKKSVDKQFLTTVSTPEPTHWPTDQNRLPDVLDFFITTGLSRLFFNVESCLDSSSNHIPVILTVSTTILKKEVRQTLYNKYTDWDSFREIVDTKLSLKIALKTEEDIEEATKHFTTTVQAACWKTSPEHLNPRPRQNKISFEIKELILNKRKLRRNNTWARTRKEKADAFAVHLAKVFTPNDADPNTDDSFIDSALSQDFQLDLPIRPTTPKEVVATISKLEDKKAPGFDLIDKKVLKELPKKAIVFLTILFNGILRTGHFPSLWRVSQVIMIPKVGKPVNELSSYRPISLLTVTSKLFESVLLHRLLEEIHQRAIIPDHQFGFRQQHGTVEQVHRICSVIRKALERKEYCSSAFLDVQQAFDRVWHKGLLYKVKTLLPCTFFPIIKSYLTERIFQIREEECTSPFHSIKAGVPQGSVLGPVLYTIYTCDLPQSEHVTLATFADDTAVLACSNCPNEASDFLQTGLQEIETWLSKWRIKTSVTKSVHVTFTLRRGDCPPVTLCNQQLPQEHCVKYLGIHLDRRLVWKQHIQKKREEINLKYRGLYWLLGRNSKLSVDNKLLIYEMLLKPIWTYGIQLWGSACDSNINIIQRVQNYILKQISNCPWFIKTSEIHEHLKIRTVKQEIKTWSMKYRKRLEMHPNKLATQLTTPDLINRLKRRQILSLDRNG

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
NWSH01007753    PCG62823.1    NEVH01007393    PNF35987.1    NEVH01007578    PNF35646.1    + More
NEVH01020940    PNF20481.1    NEVH01012089    PNF30491.1    GAKP01017773    JAC41179.1    KU543673    AMS38352.1    GEZM01053022    JAV74219.1    GFTR01008261    JAW08165.1    X17551    CAA35587.1    AY508487    AAS13459.1    GGMR01000676    MBY13295.1    GFTR01008257    JAW08169.1    ABLF02041861    GGMR01016296    MBY28915.1    GFTR01008151    JAW08275.1    GFTR01008251    JAW08175.1    GFTR01008246    JAW08180.1    GFXV01002840    MBW14645.1    ABLF02016613    LBMM01012041    KMQ86458.1    GGMR01012305    MBY24924.1    DNOY01000259    HBE18313.1    GGMR01003407    MBY16026.1    GGMR01005022    MBY17641.1    GFTR01008256    JAW08170.1    GBBI01003747    JAC14965.1    GGMR01011511    MBY24130.1    GFXV01000908    MBW12713.1    GGMR01016905    MBY29524.1    GGMR01012443    MBY25062.1    GGMR01012283    MBY24902.1    GGMR01003864    MBY16483.1    KU543687    AMS38379.1    GGMS01006655    MBY75858.1    ABLF02017874    ABLF02027031    GGMR01020516    MBY33135.1    LBMM01012078    KMQ86419.1    ABLF02021819    ABLF02021820    ABLF02055326    GGMS01006359    MBY75562.1    GGMR01013409    MBY26028.1    LBMM01009710    KMQ87932.1    ABLF02024784    ABLF02024792    GGMS01002786    MBY71989.1    GGMR01000857    MBY13476.1    ABLF02034460    M22874    M38643    GEZM01021881    JAV88842.1    M38437    AY060438    AAL25477.1    GGMS01004444    MBY73647.1    GGMR01014053    MBY26672.1    GGMR01003787    MBY16406.1    GGMS01000737    MBY69940.1    ABLF02012739    ABLF02012741    GGMR01018716    MBY31335.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF07530   PRE_C2HC
PF03372   Exo_endo_phos
PF04937   DUF659
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR006579   Pre_C2HC_dom       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR007021   DUF659       
SUPFAM
SSF56219   SSF56219        + More
SSF140996   SSF140996       
SSF53098   SSF53098       
Gene 3D
PDB
5G2X     E-value=0.0295283,     Score=91

Ontologies

Topology

Length:
823
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.220080000000001
Exp number, first 60 AAs:
0.03605
Total prob of N-in:
0.00761
outside
1  -  823
 
 

Population Genetic Test Statistics

Pi
344.715247
Theta
194.891553
Tajima's D
2.435769
CLR
1.118797
CSRT
0.938303084845758
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号