SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15081
Annotation
PREDICTED:_post-GPI_attachment_to_proteins_factor_2-like_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 4.284
 

Sequence

CDS
ATGGAATGTGTTATGTCGTGCCATCCGGCTGACCCCCGGCGCTCCCCGGTACCCGGGCCGGAGAGTGAGAAATTTGCTACCGAAGACCTCACTGAAGTAGGTGACCAGGCTTCAGTGTTCGTTAATGCTACTGGAAACAAGAAGAAACTAGTGCAGCAGGCCCTTCACCCAGGTTTATTTACCAGGGCCAAGAGTATGTCTATGAGCAACATACCAAACACCCAAACCAAAGAAAGCTCCTCTCAGCTGGATGCTGAAATGCAGCAATCAGATTTAGAAACAGTCACCCAGTGCTCCCAAATATCAAAACCACCAGACTGGCAAAGAGTTCCCATGCTACGCCATCCAAAAAAAGAAAATTATCCTCCACACCTTCTCCCGAATTAA
Protein
MECVMSCHPADPRRSPVPGPESEKFATEDLTEVGDQASVFVNATGNKKKLVQQALHPGLFTRAKSMSMSNIPNTQTKESSSQLDAEMQQSDLETVTQCSQISKPPDWQRVPMLRHPKKENYPPHLLPN

Summary

Uniprot
Pfam
PF00078   RVT_1
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR000477   RT_dom       
IPR002138   Pept_C14_p10       
SUPFAM
SSF56219   SSF56219       
Gene 3D
ProteinModelPortal

Ontologies

Topology

Length:
128
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0
Exp number, first 60 AAs:
0
Total prob of N-in:
0.17247
outside
1  -  128
 
 

Population Genetic Test Statistics

Pi
501.486226
Theta
206.385514
Tajima's D
3.963898
CLR
0.340495
CSRT
0.998800059997
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号