SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15078
Annotation
reverse_transcriptase_[Bombyx_mori]
Full name
RNA-directed DNA polymerase from mobile element jockey      
Alternative Name
Reverse transcriptase
Location in the cell
Nuclear   Reliability : 3.287
 

Sequence

CDS
ATGTTCACGATTTACTTCCACGGCAAAGGAATAACATCGGGTAATAAAAAACAAACCCGCAAAAAGCAAACTCGCAAAATTATAATTTGCGTACTTAGTGGTGAAAGGACGTCTTGTAACTGCCATCGCACGAATGTGAACGGTAGGCGTCTCGACGCGTTCATAGACGACCTCACATTCGAAATATTCAACCCCCCGACCCCCACGTGCTATCCGTATAACGCCGCGCGTCGTCCGAGCACAATAGATCTGGCACTGCTGAGGAACGTAACTCTGCGCTTACGCTCCATCGAGGCAATGTCAGAACTCGACTCAGACCACCGACCTGTCGTCATGCAGCTCGGTCGCCCACTCAATCGCGAACCAGATACGAGGACCATGGTGGATTGGAAGAAGCTGGGCACGTGCTTAGCTGACACCGCTCCACCAATCCTCCCTTGCGGCCCGGATTCAACTCCATCCCCCGAGGATACCGTCGAATCCATAAACATCTTCACTGATCACGTCTCGACGGCGATCATAAGATCCTCGAAACAAGTCGATGTGGAGGACTGCTTCCACCGCATCAGACTTTCCCCCGATCTTAGGGACCTCGTTAGAATTAGAAACGCGGCAATCCGGGCCTACGATCGATATCCCACGGATTTAAACCGGACTTGGATGCGTCGCTTACAGCGGGAGGTCAAATCCCGCTTAAGCGACGCCCGAAACGAAAACTGGGATAGTTATTTAGAAGAACTCGCGCCCACTCACCAAGCATACTGGCAACTAGCTAGGACCCTCAAGTCCGAAACTATAGCCACTATGCCGCCTCTCGTACGCCCCTCAGGCCAATCACCGGCTTACGATGACGATGACAAGGCAGAGTTGCTGGCCGATGCACTGCAAGAACAGTGCACCACCAGCACTCAACACGCGGACCGCGAACACACCGAGTTCGTCGCCAGGGAGGTCGAGCGCAGAGCTTCCCTGCCGCCCTCGGACGCGTTACCCCCCATTACCACTTCCGAGGTTAAGGAGGCGATCGATAGCCTACAACCACGGAAAGCTCCCGGCTCCGACGGCATCCGCAACCGCGCGCTTAAATTGTTACCAGCCCAACTGATAACGATGTTGGCCACCATATTAAATGCTGCTATGACGAACTGCATCTTTCCCGCGGCGTGGAAAGAAGCGGACGTTATCGGCATACACAAGCCGGGCAAACCGAAGAACGAAACCGCGAGTTACCGCCCCATCAGTCTCCTCCCGGCGATAGGCAAACTATACGAACGGCTCCTTCGTAAACGCCTCTGGGACTTCGTATCCGCGAATAAAATTCTTATAGACGAGCAGTTTGGATTCCGCGCCAGACACTCGTGCGTCCATCAAGTGCACCGCCTCACGGAGCACATCTTACTAGGGCTGAACAGGCGGAAACCCATTCCGACAGGAGCCCTCTTCTTCGATATAGCGAAGGCGTTCGACAAAGTCTAG
Protein
MFTIYFHGKGITSGNKKQTRKKQTRKIIICVLSGERTSCNCHRTNVNGRRLDAFIDDLTFEIFNPPTPTCYPYNAARRPSTIDLALLRNVTLRLRSIEAMSELDSDHRPVVMQLGRPLNREPDTRTMVDWKKLGTCLADTAPPILPCGPDSTPSPEDTVESINIFTDHVSTAIIRSSKQVDVEDCFHRIRLSPDLRDLVRIRNAAIRAYDRYPTDLNRTWMRRLQREVKSRLSDARNENWDSYLEELAPTHQAYWQLARTLKSETIATMPPLVRPSGQSPAYDDDDKAELLADALQEQCTTSTQHADREHTEFVAREVERRASLPPSDALPPITTSEVKEAIDSLQPRKAPGSDGIRNRALKLLPAQLITMLATILNAAMTNCIFPAAWKEADVIGIHKPGKPKNETASYRPISLLPAIGKLYERLLRKRLWDFVSANKILIDEQFGFRARHSCVHQVHRLTEHILLGLNRRKPIPTGALFFDIAKAFDKV

Summary

Catalytic Activity
a 2'-deoxyribonucleoside 5'-triphosphate + DNA(n) = diphosphate + DNA(n+1)
Cofactor
Mg(2+)
Mn(2+)
Miscellaneous
Prefers poly(rC) and poly(rA) as template and activated DNA is not effective.
Keywords
Nucleotidyltransferase   RNA-directed DNA polymerase   Transferase   Transposable element  
Feature
chain  RNA-directed DNA polymerase from mobile element jockey
EC Number
2.7.7.49
EMBL
U07847    AAA17752.1    AB018558    BAA76304.1    AB055391    BAB21761.1    + More
AF081103    AAC72921.1    KQ459265    KPJ02064.1    KQ973342    KXZ75569.1    GEZM01008457    JAV94772.1    KQ971729    KYB24751.1    GGMS01006359    MBY75562.1    GBBI01004395    JAC14317.1    AJWK01012157    GALX01005299    JAB63167.1    ABLF02042385    KQ973412    EFA12510.2    S59870    AAB26437.2    GBBI01004571    JAC14141.1    GGMR01018716    MBY31335.1    KQ973363    EFA13335.2    KK119261    KFM75202.1    GGMR01002322    MBY14941.1    GGMR01013409    MBY26028.1    NEVH01006736    PNF36716.1    GGMS01002992    MBY72195.1    GGFL01005012    MBW69190.1    L79944    AAB04627.1    GGMR01006581    MBY19200.1    GGFJ01002256    MBW51397.1    GGFJ01002257    MBW51398.1    GGFJ01001844    MBW50985.1    GGFJ01001842    MBW50983.1    GGFL01004957    MBW69135.1    GGFJ01001843    MBW50984.1    ABLF02024246    ABLF02036316    ABLF02036319    ABLF02048663    ABLF02066977    ABLF02040174    ABLF02040183    ABLF02055266    GGMR01006408    MBY19027.1    GGMR01016297    MBY28916.1    ABLF02007779    ABLF02007782    ABLF02050375    GFTR01008262    JAW08164.1    RPOV01000134    RPJ78669.1    GGMS01002955    MBY72158.1    KF280391    AIE77315.1    GEZM01053022    JAV74219.1    ABLF02016634    GFTR01008169    JAW08257.1    KK119069    KFM74603.1    GEZM01084970    JAV60359.1    GFTR01008038    JAW08388.1    GGMR01003407    MBY16026.1    GGMR01012305    MBY24924.1    JRES01000644    KNC29657.1    GEZM01084969    JAV60363.1    GEDC01029594    JAS07704.1    GFTR01008279    JAW08147.1    M38437    KK115285    KFM64681.1    GFTR01008261    JAW08165.1    GFTR01007997    JAW08429.1    ABLF02034467    NNAY01003095    OXU19992.1    NEVH01019963    PNF22185.1    NWSH01007753    PCG62823.1    ABLF02034460    GGMS01015632    MBY84835.1    GEZM01099921    GEZM01099920    GEZM01099918    GEZM01099906    JAV53125.1    GGMS01017365    MBY86568.1    LBMM01014024    KMQ85369.1    GGMR01000226    MBY12845.1    GFTR01008257    JAW08169.1    GGMR01004661    MBY17280.1    GALX01005359    JAB63107.1    GBBI01003810    JAC14902.1    GDHC01018248    JAQ00381.1    GGMR01014053    MBY26672.1    GGMR01012443    MBY25062.1    ABLF02014118    ABLF02014121    ABLF02054790    ABLF02041861    GFTR01008271    JAW08155.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF07530   PRE_C2HC
PF07727   RVT_2
PF10551   MULE
PF03564   DUF1759
PF18701   DUF5641
PF00665   rve
PF05380   Peptidase_A17
PF17921   Integrase_H2C2
PF05585   DUF1758
PF03372   Exo_endo_phos
Interpro
IPR036691   Endo/exonu/phosph_ase_sf        + More
IPR005135   Endo/exonuclease/phosphatase       
IPR000477   RT_dom       
IPR006579   Pre_C2HC_dom       
IPR013103   RVT_2       
IPR013083   Znf_RING/FYVE/PHD       
IPR018289   MULE_transposase_dom       
IPR041588   Integrase_H2C2       
IPR036397   RNaseH_sf       
IPR005312   DUF1759       
IPR040676   DUF5641       
IPR008737   Peptidase_asp_put       
IPR008042   Retrotrans_Pao       
IPR012337   RNaseH-like_sf       
IPR001584   Integrase_cat-core       
SUPFAM
SSF56219   SSF56219        + More
SSF53098   SSF53098       
Gene 3D

Ontologies

Topology

Length:
491
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
3.07345
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00266
outside
1  -  491
 
 

Population Genetic Test Statistics

Pi
27.113755
Theta
22.597912
Tajima's D
0.400592
CLR
0
CSRT
0.490075496225189
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号