SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15056
Pre Gene Modal
BGIBMGA009030
Annotation
hypothetical_protein_KGM_08988_[Danaus_plexippus]
Location in the cell
Nuclear   Reliability : 3.212
 

Sequence

CDS
ATGTATCCGGAAAGAATAATGTCGCCGTACACGGTGATCATCAGACGCAGTGGGAACCCCTTCGAGCTAGCTCACGTGTTGGTGTCGTGGCTAATAGGAGCTGGATATGACGCATACGTGGTCGTCGGCTGTGCCACCAGAGACACTTGCATGGCTATAAAGTACAGGAGCATTTGTGCTGACATCCCTGATGAGAGCGAGAAAAAAGAAGAAATTCCACCACCTGACGAAGAGCCCAGATATCGCCTGGTGCCCCTACCGGATCTCACTTCTAAGTACTGCCGTGATATGGACAAGAAAGCCGATGATAAGAAACAAGCTGAACTGAACAAGACCGAGAAAGAGCGACTTCGTAAAATTGCTGATTTGGAAAAAGCCCCGGCTGACGCTATTAACGGGTGGAGAACTCACGCCTGGGTCCTCGTGCTGCCGGGATACATGGGAATCGACGAACCTTTCTTCATAGAGCCGAGCGAAGGCGAAGGTCATCTCCTCGACTCAGAAAAATACCAATTCATAGACAGCGTGTACAATCACGAAAACTACTATGCAAACGTCCAAAGCACAGACATTGGGTTGGACAGCCTGAATTATGATCTGAGCGACCTCTCAGCGTGGGAGCATCTTCTGGCCGGCGAGCCCCACCATCGGAGGCAGATGGTCGGCATTGACATCGCCGACAAGAAGACAGCTGTGCAAACAGAGAAGCATCTGGATATGCCAGTCAGCTGGGTTGAGAAACTGGAGATTAGTACTGATGAGTACGGTCAAAGATATCCGGGCAGCCACAAAGTGATACACTACAAGAAAGTTTTACTGGATAAGTTCTCGCCCTACTCCGAGAGGGATGGTGTAGTGAAGAGGATCAGAACGTTTGAGGACTACGCTTTGACCGTCCCGCTGATCACGTACGAGTGGTACAAGCATCGCGTCGACAAAATGGAAACCGTTCGAATAGATCACACGAAGCGTGAGATACGCGAGACGTTCGGTATCGGAAGGAGGGATCATTTACTCAAGCACGTGTACTCCATGGACGCGCTGGTCGGCTCTGTGGAGGCAGTCAGGACCATGGAGTTCAATTACTACGCCCGACTTGACCACCTCACGAGGCTGGTCTGCACTACCCTTACATTCGATGAATATTATTCGAACAGAAGCGACAGATTAGAATCAAGATTAGTAATATATACAGAAGGAACGAAAGAAACTAAACGTCAAATAAAGGACGTAACTGAGACGTACAGCAGAAACCATGAGATCCCATCAAAGCAAGACGTCTGGAAGAAGATCTTCCACCTCCAGGACAATACTATAGAACTGCTGTACCAATACGCGTACAATTACGTAACTAACAACACAAGGAGCTATATAAAACCTAACTTGGCTGAGACCGGCGGGAAAATCTTGTTCTATCCCGACAAAACCTCCGGGTATATCGCCGACCCGAACGCTAAACAACCCCGCGACTTGGAAGTGTATTACGCCCTCTGCGAAAACATGGAATGGGAGCACGCGACCACGAAGCAGATACGCGACAGAGAGACCGACGTCAATGGATATCTGCGGCAGAGACACAAGGAGCTCACCGAACCGATGCTGGCCGTCGCGCTCTTCGATACCGAGAAGAACGAGGCCGCCAAGAAAGGCTGGAAGGAGCAGGAAGCAAAAAAAGCCGAAGTGACCGAACGAGAAAAGGAAGCTGAAATCGATCCGTTAGCTCCGTACCTGGCTCGGATGTTCGGCTCGGGGCACGGCTCCGGGAATCCGCTCACTGTCAAAGAAGCCACTCTAATCAGGGAACAGTGCATCAACGATTTCAAATCCAAGCAATTGGCCCGACAGATGCTCGTCCAGGAGAGGTTCGAAAAGTTCAAAATATTAAATCACACAAGTATTACAATACAACTTTATCCCTGCTGTCCATCTGTAAACCACAAGACAATGGCAAAGTGTGGAGCATGTGGAAAATTCTTGTCAACCGCGGACTGTGCGCGTTGTAGTAAATGCAGTGACAATTTCCATAAAGGATGCGTGGCAATCCCATCTACGGGCGCTGCGCCTCGGGGCTGGATCTGCCCTAGTTGCTCAGCGAAGGTACCTCGTGGGGATAATGCGGCAACTCCTGTACGAGGGTTGACAACTGTCGGGGTGCATCACACTTCGAGCGAGGGAGATGTTGATGCAGATACGATGAATCGGTCGCTGGAGTCTCGTGTCGACCTTGGCTTAGAAATCCGATCTTTTAAGGATGAGCTGGTGGGCCTAAGAACTGACTTGAGAGAGTGCCGAAATGATATCGCTGAGTTTAAGGAGCTCCTCAAGTCTTGTCATGGACGCATCGACGCGGTGGAAGCCCGAGTGCTTGGTCTTGAGGCTCGTCTAGCAGAGATCGTCTCAACAGCAGCAGGTTCTGACTTGGATTCCACGGTGGCTGAACTTCGCATTCAGCTGCGTGAACGCGACCAGGACTTGCTCAGGAATGATATCGACATCATTGGTTTGCCGGAAGTCCGTGAAGAAAGCGCTTGTCATTTAGTCCAGGTTGTGGCGGTAAAACTGGGAGTGAAACTTGACGTGCGCGACATAGTTCACGCGGAGCGGATTGGTGCAGTAAGACGCAATTTCACTGAGGGCGACGAGAATCGTCCTCGTATACTATCAGTACGACTGGCTCGTCGCTCGGTTCGCGATGCACTATTGAAGGGAGCCCGCGTGCGCCGTAACCTCTCCACTACTGATTTAGATGTACCTGGCCCCGTCCGTACTGTATATTTAAATGAACGTTTGTCCGCATATAATCGCAAGCTGTTTGGTACTACCCGTCAAAAGGGAAAGGATAAAGGTTGGAAGTTTGGGGAGGAGGGCCGTGCACCTTGTGTGTCAGGCTACAGGCTCAAGCATGTTCCTCGACCAGTTAGTATAAGGGGTGGTCGTGGTGGCGGGGTGGCCTTTTATCTCAGAGCTGATATAAGTGCTCGGGTGTGTATGCACCCCGGACATTTGGATGTTGAACAGTTGTGGATAACAGTGAATTTTTGCGGGAAAAAGCTATTAATAGGCACTGCATATCGCCCCCCTTGGTCTGATCTGGAAAATTTCCTAGAGGGATTGACCGAAAGTATTGGTGCTATGGCTCCTTATGACAATATAGTGCTTCTCGGAGATTTTAATGTAAACCTATTGGACTGTAATTGTTCTAGAACAAAAAAAATAAATGAATTTCTAAGCCACTTCAGTCTCTCGCAAATAGTAAGGACTGCAACACACTTTATGAGTGGTAGTAGTACTCTGTTGGATGTTATTTGTACTGACATTGGCATTAATGATGTCGGGGTTGATTATATTCCCGAGCTTGGCCACCATGCTTTTGTCACATGTGAGACTTTGATCCGAAAGGAAAGACCAATGTCTAGAATGATCACTTCCCGTCAATTTAAAAATATCTTGGAGGAGTTCTTTACTCAGGATCTAAATACAATACCCTGGTCGAACATCGCCCTCCTGGATGACGTTGACACGATGGTTTACACTTTTTCTATGTTTATTCTGTACCTGTACGATCTCCATGCTCCGCACAAAACCCTGAAATTCAAAACACGTTCCACTCCTTGGATTACTGATAATGTTCGATTATTGTTTAAATTGCGAGATGCTGCACGCTATAGATCACATGTAACTCAGGTTCATAGTCATAAACAGTATTATTTAGACCTTAAGAAGCAGGCAGCTAGCGTCTTAGCATCGGAAAAAAAGACCTACTACAACAATTATATTAATAGCAACTTCGGAAACCCTAAAAAGTTATGGAAAAATCTGAAATCTGATGTGATTCCGTCACATCAGGAGAAAGCATTGCCTGAACACCTTAATGACGCTAATGCTATCAATGATGCTTTTCTGGATGTACCCGGGGTCTGTAGTTCTGACGTTTCAGGATACTCATTCTTTGAGTATTCTAACACATCTCCAAAGTTTACGCTTAAAACTGTCAACCAGGATACGGTTCTTAAGATTATTAACAGCATTAAATCCAACGCTCAAGGCACTGACGGGATAAGCGGTGAGATGATATCGCTCTCACTGCCTTCAACATTGGAGGCGATTACTAGCATTATCAATAAGTCCATTGATACAAATACGTTTCCTGCTCAGTGGCGATGTTCTGTGGTTAGCCCTATTCCGAAAGTCACGCACCCTCAAGCTTTTAAAGATCTTAGGCCTATTAGTGTGTTGCCTTTTCTATCCAAGATCTTGGAGAAGGTAGTTTACTCACAGGTAGCAGCATATATCGAATCAAATAACATTCTTCCAGTGCTTCAATCGGGTTTCAGAAAAAGCCGAGGAACGGCCGCTGCTCTTACTGACATTGTGGGTAATATTCTCGAGGCTCGTGACAGGAGCCAGGGTACGATACTGACGCTGCTGGATTTCTCACGGGCTTTTGATACAATTAACACTGCCTTACTCTTAGCAAAATTAACTCACTATGGGTTCTCTGATAATGCTGTGCAATGGTTTAGCAGTTATATGTCGAGTAGAACGCAATTTGTACAGATACGGAAAGAAGATGGAACTAAACTAACCTCTACTTCTAAGCCGATTACTAGAGGCGTTCCCCAAGGTTCTGTCCTGGGACCATTGTTATTTATTTTGTACAGTGCAGATATCACTCAGTGTTTCAAGAATTGTAAATACCATGTTTATGCTGACGATGTACAATTATACCACTCTTTTGATGTTGGAGATACCCCTTCTGCTGTCAGTTTTATCAATGAGGATCTGCAGAGGATTGTCTCTTGGTCTGAACAGAATTCCTTAGTATTGAACCCCTCTAAGTCTAAATACATGATACTAGGCAGTAAATCTCAGATAGCAAAGATTTTATCACTCGATCCTAAGGTGACTGTTTCGGGTAAGGAAATTGATCGGGTGGAGTTAGCATGCAGTTTGGGTTTGACAATTGATCCCGAATTGCGATTCGAGGCCCATATTACAAAGAATTTAAGAACTTGTTTTTACAGACTGAAGATTCTGTACTCGTTTAGACAGTACTTGAACAACGAATACAAAAACAAGAGACTGTGGTACTTAGCGAACCAATTCATTCTGACACCCGAGAAAGAGAGTAACTACTTCACTATGAGTGCGGAATTAGCATTCCAAGTACACACACTAGAGGTGCGATTGACAAGGCATCAAGATTTGTCAGGTCCAAGATATAAAATCCTCCTAGAGTATCTTGACAAACATCCATTACTGAAGGAATATAATCGTTCAAAGAATTATTATGGCATAAAATAG
Protein
MYPERIMSPYTVIIRRSGNPFELAHVLVSWLIGAGYDAYVVVGCATRDTCMAIKYRSICADIPDESEKKEEIPPPDEEPRYRLVPLPDLTSKYCRDMDKKADDKKQAELNKTEKERLRKIADLEKAPADAINGWRTHAWVLVLPGYMGIDEPFFIEPSEGEGHLLDSEKYQFIDSVYNHENYYANVQSTDIGLDSLNYDLSDLSAWEHLLAGEPHHRRQMVGIDIADKKTAVQTEKHLDMPVSWVEKLEISTDEYGQRYPGSHKVIHYKKVLLDKFSPYSERDGVVKRIRTFEDYALTVPLITYEWYKHRVDKMETVRIDHTKREIRETFGIGRRDHLLKHVYSMDALVGSVEAVRTMEFNYYARLDHLTRLVCTTLTFDEYYSNRSDRLESRLVIYTEGTKETKRQIKDVTETYSRNHEIPSKQDVWKKIFHLQDNTIELLYQYAYNYVTNNTRSYIKPNLAETGGKILFYPDKTSGYIADPNAKQPRDLEVYYALCENMEWEHATTKQIRDRETDVNGYLRQRHKELTEPMLAVALFDTEKNEAAKKGWKEQEAKKAEVTEREKEAEIDPLAPYLARMFGSGHGSGNPLTVKEATLIREQCINDFKSKQLARQMLVQERFEKFKILNHTSITIQLYPCCPSVNHKTMAKCGACGKFLSTADCARCSKCSDNFHKGCVAIPSTGAAPRGWICPSCSAKVPRGDNAATPVRGLTTVGVHHTSSEGDVDADTMNRSLESRVDLGLEIRSFKDELVGLRTDLRECRNDIAEFKELLKSCHGRIDAVEARVLGLEARLAEIVSTAAGSDLDSTVAELRIQLRERDQDLLRNDIDIIGLPEVREESACHLVQVVAVKLGVKLDVRDIVHAERIGAVRRNFTEGDENRPRILSVRLARRSVRDALLKGARVRRNLSTTDLDVPGPVRTVYLNERLSAYNRKLFGTTRQKGKDKGWKFGEEGRAPCVSGYRLKHVPRPVSIRGGRGGGVAFYLRADISARVCMHPGHLDVEQLWITVNFCGKKLLIGTAYRPPWSDLENFLEGLTESIGAMAPYDNIVLLGDFNVNLLDCNCSRTKKINEFLSHFSLSQIVRTATHFMSGSSTLLDVICTDIGINDVGVDYIPELGHHAFVTCETLIRKERPMSRMITSRQFKNILEEFFTQDLNTIPWSNIALLDDVDTMVYTFSMFILYLYDLHAPHKTLKFKTRSTPWITDNVRLLFKLRDAARYRSHVTQVHSHKQYYLDLKKQAASVLASEKKTYYNNYINSNFGNPKKLWKNLKSDVIPSHQEKALPEHLNDANAINDAFLDVPGVCSSDVSGYSFFEYSNTSPKFTLKTVNQDTVLKIINSIKSNAQGTDGISGEMISLSLPSTLEAITSIINKSIDTNTFPAQWRCSVVSPIPKVTHPQAFKDLRPISVLPFLSKILEKVVYSQVAAYIESNNILPVLQSGFRKSRGTAAALTDIVGNILEARDRSQGTILTLLDFSRAFDTINTALLLAKLTHYGFSDNAVQWFSSYMSSRTQFVQIRKEDGTKLTSTSKPITRGVPQGSVLGPLLFILYSADITQCFKNCKYHVYADDVQLYHSFDVGDTPSAVSFINEDLQRIVSWSEQNSLVLNPSKSKYMILGSKSQIAKILSLDPKVTVSGKEIDRVELACSLGLTIDPELRFEAHITKNLRTCFYRLKILYSFRQYLNNEYKNKRLWYLANQFILTPEKESNYFTMSAELAFQVHTLEVRLTRHQDLSGPRYKILLEYLDKHPLLKEYNRSKNYYGIK

Summary

Uniprot
ProteinModelPortal
PDB
6AR3     E-value=0.00309909,     Score=102

Ontologies

Topology

Length:
1767
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
8.14944999999997
Exp number, first 60 AAs:
8.0658
Total prob of N-in:
0.35494
outside
1  -  1767
 
 

Population Genetic Test Statistics

Pi
329.98324
Theta
172.940144
Tajima's D
3.251634
CLR
0.393307
CSRT
0.987300634968252
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号