SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15052
Pre Gene Modal
BGIBMGA009860
Annotation
PREDICTED:_piggyBac_transposable_element-derived_protein_4-like_isoform_X4_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 3.08
 

Sequence

CDS
ATGGAATCTCAACGTGCTGCAGCAGGTCGAGGCAGAAGTGGTCGTGCTGGCGGTCAACGTGTTCGTGGTCATCACCAAGCCCGACCTTCGGCCTCTGAATCACTCGTCACTATGCCAATCGAGGCGTTGCCGGCGGGTCGAGCGATGGAGACGCCGATGCACCCGAAGAGGGTAAGGGTGCTCGAGCCCGTAGTGGAAAACCCTAGATCAGAAATGTGGGGATCCAACGCTTCGTCCCCAGCCAGGAGGGACCAGGAGACGCCTCCGGTGCCATCACCTGCCCTATACGTAGAATGTGGGCCTAGCAGCGGGGCAAGCACGCCGACCACCGAGCGGCCTGCAAGTCTGAGTCACGTCTCAAAGGAAGCTCGGCGTGAATTAATCCCTTCGTCCTCTTCGTCCACTCGACCTCTTCGCGACGAAGAGATTTTGACATTGCTCAATTACGGCAGCGAAGAAGAGTCGGAGGAAGAGGAGGACGAAGAGACTATGCAGCGGCTGACGGTGCCGCACTCGACCAGGATGTGGTTAGACGAAGAGGATGAGGAAGTTGAAAGAGGTGAAGAGAGGATCCCTCCTCTCCCGAGAGATAACATTAATATAGAGCAACCTCCTCAACCTCTTCGTCTATCCACATCCACCTCACCGACGGCTCTTTCGCCCTCTGTGGCGCTAGGGCCAACTAATAAATTTATGTTTGAATGGAGAACGGCGCCAATGCCTGCAATCGAACCTGATTTAAGGCGAGAACCGTTCTCCCAAATTAGTGGTCCAAAGGTTTCTTTCGCGACTCCGTATGATGCATTCATTGCCATATGGGATCGTGAAATAATGGAATCGATAGTCGAGGAAACCAACATTTACGCACAGCAGCTGGCAACGGTCATGCTGGAGACTGGGACGATCCGCCCTCATAGCTGGATTACTCGATGGCAAGATACGGATGTAAACGAACTTTACACGTATTTTGCTATCATTCTGGCTATGGGGGTGTTCATCAAAAGCTGCCTGACCGAGTATTGGTGCACGGCACAAGACGTATTTTATACACCAGGCTTCTCCGCCCAAATGTCGTATGACCGTTTCCGGCTGCTGTCAAGGTGCCTACACTTTTCTAATAACACTGCTTGTGATCTTGCAATGTTGACACGACGCCAGGTCATGCTGTACAAAATACAACCGTTAATAGACCACTTAAATAAAAAATTTGCGGAACTTTACAATTTGGGTCAAAATTTAGCAGTGGATGAAAGTTTGACGATGTGGAAAGGCTGGCTTGATATAAACCAGTTCATTCCACAAAAGGCAGCGACAGTTGGGATCAAAACTTATGAAGTTTGTGAATCGCAGAGTGGTTACCTGTGGCGGTTTGAAGTTCACGCTGGCCATGACATCTCGGCTTCACAGGACGATCCAATTTCTGGCACAGTACCAGCTCTCGTGCTCAGACTTTTAAATGGTCTTGAGCATAAAGGGCACACAATATGGATGGATAATTTTTATAACTCTCCAGCGCTAGCCCGAGAACTTAAGACACGCGGCTTTGACTGTGTGGGCACACTGCGGACTAACCGACAATTTGTGCCGTACGAAGTGACGTCCCTTACAAAAAGGGATATGACAGTCGGTCAAGTGATGGGATGCACCTCGGGAGATGTGGATATTTTGGTGTGGAAAGATAAAGGCCGGGTGGCATTTATTTCCACATACCATGGTCTTGCATCTGTTACGTTTGAGGAAAGACTGAAGCCGACTGTCGCGTACGATTATAATATTTGTATGGGCGGAGTAGACCGCAAGGACCAGCAGCTTGCAGTGTATCCCATAGAAAGAAGAAGGACAAAAGTTTGGTACAAGAGATTCTTTAGAAGGCTCTTGAACGCTAGTGTCTTGAACTCGCACATACTACACCAAAATCAGTCATTCTCACACCGGAAATTCCGGACGGTGTTAATCACTGAACTATTGAGTGCACACCGTACACAACCACCTAGCACACTCACCCCAACACATGTACATTGCCCGGCGCAGTATGGCCTGACCAAGAGCGGTAAATCAGACCGCCTTAGGCGCCAGTGTGCCGTCTGCTCCAGGCGGACTCACACATATTGCAAGGCCTGCAACGTGGCAATGTGCATTTTCACTTGCTACGAGACATACCACACTACACATCGACACTTTACCGCCACCTCAGTACCATGTGAGAGGATTTTTTCAAAATCTGGTAAACTCATTTCTGACCGACGTAACAGGCTTTCGGTAGAAAAAGTAAAAAAGCTGATGTTTTTATGCACCAATAAGAAATAA
Protein
MESQRAAAGRGRSGRAGGQRVRGHHQARPSASESLVTMPIEALPAGRAMETPMHPKRVRVLEPVVENPRSEMWGSNASSPARRDQETPPVPSPALYVECGPSSGASTPTTERPASLSHVSKEARRELIPSSSSSTRPLRDEEILTLLNYGSEEESEEEEDEETMQRLTVPHSTRMWLDEEDEEVERGEERIPPLPRDNINIEQPPQPLRLSTSTSPTALSPSVALGPTNKFMFEWRTAPMPAIEPDLRREPFSQISGPKVSFATPYDAFIAIWDREIMESIVEETNIYAQQLATVMLETGTIRPHSWITRWQDTDVNELYTYFAIILAMGVFIKSCLTEYWCTAQDVFYTPGFSAQMSYDRFRLLSRCLHFSNNTACDLAMLTRRQVMLYKIQPLIDHLNKKFAELYNLGQNLAVDESLTMWKGWLDINQFIPQKAATVGIKTYEVCESQSGYLWRFEVHAGHDISASQDDPISGTVPALVLRLLNGLEHKGHTIWMDNFYNSPALARELKTRGFDCVGTLRTNRQFVPYEVTSLTKRDMTVGQVMGCTSGDVDILVWKDKGRVAFISTYHGLASVTFEERLKPTVAYDYNICMGGVDRKDQQLAVYPIERRRTKVWYKRFFRRLLNASVLNSHILHQNQSFSHRKFRTVLITELLSAHRTQPPSTLTPTHVHCPAQYGLTKSGKSDRLRRQCAVCSRRTHTYCKACNVAMCIFTCYETYHTTHRHFTATSVPCERIFSKSGKLISDRRNRLSVEKVKKLMFLCTNKK

Summary

Pfam
PF13843   DDE_Tnp_1_7
Interpro
IPR029526   PGBD       

Ontologies

Topology

Length:
768
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
2.38524000000001
Exp number, first 60 AAs:
0.00079
Total prob of N-in:
0.10427
outside
1  -  768
 
 

Population Genetic Test Statistics

Pi
196.004866
Theta
190.574965
Tajima's D
1.431618
CLR
0.560114
CSRT
0.773961301934903
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号