SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15028
Annotation
reverse_transcriptase_[Danaus_plexippus]
Location in the cell
Mitochondrial   Reliability : 1.032 Peroxisomal   Reliability : 1.07 PlasmaMembrane   Reliability : 1.129
 

Sequence

CDS
ATGGAGGGTCTCTTGGAGACGCTGGATGAGGATCCGTGGGGGCGGCCCTATCATATGGTGCGCAATAAAATGCGCCCATGGGCCCCCCCGATCACGGAGCGTCTCCAGCCTCAGCAGCTGCGGGACATCGTCTCGGCGCTGTTCCCGCAGGAGCGGGAGGGATTTGTCGCTCCCGCTATGGACGCGCCGCCGGACTACGACAGCGAAGCCCCTGCTGAGGTGCCCCATATAACGGGGGCGGAGCTCCGTGTGGCCGTTCGCAAAATGTGCGCGAAGGACACTGCACCCGGCCCGGATGGCGTTCATGGCCGGGTTTGGGCCTTGGCTCTTGGTGCCCTAGGGGACCGACTCTTGAGACTTTACAACTCCTGCCTCGAGTCGGGACGGTTTCCTTCATCGTGGAGGACGGGCAGACTCGTGCTGTTGAGAAAGGAGGGGCGCCCGGCGGATACTGCCGCCGGGTACCGTCCCATCGTGTTGCTGGATGAGGTGGGCAAGCTGCTGGAACGCATTCTGGCAGCCCGCATCATCCAGCATCTAGTCGGGGTGGGACCCGATCTGTCGGCGGAGCAGTATGGTTTCCGAGAGGGCCGCTCAACGGTAGACGCGATCCTTCGTGTGCGGGCCCTCTCGGAGGAGGCCGTCTCCAGGGGTGGGGTGGCTTTGGCGGTGTCGCTCGATATCGCCAATGCGTTTAACACCCTGCCCTGGTCCGTGATAGGGGGGGCGCTGGAACGACATAGAGTGCCCCCCTACCTTCGCCGGCTGGTGGGTTCCTACTTAGAGGACAGATCGGTCACGTGTACCGGACACGGTGGGATCCTGCACCGGTTCCCGGTCGTGCGCGGTGTTCCACAGGGGTCGGTGCTCGGCCCCCTTTTGTGGAATATCGGGTATGACTGGGTGCTGAGAGGTGCCCTCCTCCCGGGCCTGAGCGTAATCTGTTACGCAGACGACACGTTGGTCGTGGCCCGGGGGGGAGTTTTGCTGAGTCTGCCCGTCTTGCTACGGCTGGGGCCCCGGAGAGTGCCACCTGTCGATGCCCATATCGTGGTTGGAGGCGTCCGTATCGGGGTCGGGGTGCAGTTGAAGTACCTAGGCCTCATTCTAGACAGTCGTTGGACCTTCCGTGCTCACTTTCAGAACCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTTCTGCCCAACGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACGGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTGGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCCTTTGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTTCTGGAAGCGGAGGCGCTCGCCGCTGACTATAAGTGGCGGGCTGACCTTCGTGCCCGGGGCGTGGCGCGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGACCAATCTCGGCGGTCCGTGCTGGAGTCATGGTCCAGACGGCTGGCTGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGTTTCGGTGAGTTCCTGCACCGGATCACAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGACTTGGACACGGCAGAGCATACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAACCGACTTGTCGTTGCCGAGTGTTGTGGCATCGATGCTCGGCGACGACGAGTCGTGGAAGGCGATGCTCGACTTCTGCGAGTGCACCATCTCGCAGAAGGAGGCGGCGGGGCGCGTGAGAGACGCACAATCCCGCCGCCGTCGAGCGGGGGCCAGGGAGGCGGATCTCGCCCAAGCCCTGGCCCTCTAA
Protein
MEGLLETLDEDPWGRPYHMVRNKMRPWAPPITERLQPQQLRDIVSALFPQEREGFVAPAMDAPPDYDSEAPAEVPHITGAELRVAVRKMCAKDTAPGPDGVHGRVWALALGALGDRLLRLYNSCLESGRFPSSWRTGRLVLLRKEGRPADTAAGYRPIVLLDEVGKLLERILAARIIQHLVGVGPDLSAEQYGFREGRSTVDAILRVRALSEEAVSRGGVALAVSLDIANAFNTLPWSVIGGALERHRVPPYLRRLVGSYLEDRSVTCTGHGGILHRFPVVRGVPQGSVLGPLLWNIGYDWVLRGALLPGLSVICYADDTLVVARGGVLLSLPVLLRLGPRRVPPVDAHIVVGGVRIGVGVQLKYLGLILDSRWTFRAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYKWRADLRARGVARPSPSVVRARRDQSRRSVLESWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRITAEPTAECHHCGCDLDTAEHTLVACPAWEGWRRVLVAKIGTDLSLPSVVASMLGDDESWKAMLDFCECTISQKEAAGRVRDAQSRRRRAGAREADLAQALAL

Summary

EMBL
AB090825    BAC57926.1    AB078935    BAC06462.1    AB078931    BAC06456.1    + More
AB078930    BAC06454.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    LBMM01012027    KMQ86470.1    LBMM01006954    KMQ90166.1    LBMM01015565    KMQ84759.1    LBMM01008682    KMQ88705.1    LBMM01005733    KMQ91252.1    GGMR01000779    MBY13398.1    LBMM01002052    KMQ95336.1    ABLF02011238    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01007425    KMQ89740.1    LBMM01014122    KMQ85315.1    GGMR01015159    MBY27778.1    GGMR01014195    MBY26814.1    GFXV01002090    MBW13895.1    ABLF02013358    ABLF02013361    ABLF02054869    GGMR01004600    MBY17219.1    ABLF02034925    GGMR01011682    MBY24301.1    LBMM01006110    KMQ90925.1    GFXV01003903    MBW15708.1    ABLF02014378    LBMM01019839    KMQ83438.1    ABLF02018808    GGMR01006838    MBY19457.1    ABLF02041557    LBMM01006063    KMQ90967.1    LBMM01005465    KMQ91492.1    LBMM01004262    KMQ92649.1    LBMM01003245    KMQ93755.1    GGMR01015354    MBY27973.1    ABLF02059310    LBMM01004261    KMQ92650.1    ABLF02023257    GGMR01019493    MBY32112.1    KU543683    AMS38371.1    GGMR01012748    MBY25367.1    ABLF02012448    ABLF02012450    ABLF02012455    ABLF02012460    GGFL01004044    MBW68222.1    GAPW01000192    JAC13406.1    GEHC01000915    JAV46730.1    GALA01001777    JAA93075.1    LBMM01006977    KMQ90149.1    ABLF02010223    GAMC01020517    JAB86038.1    GAMC01020519    GAMC01020515    JAB86040.1    LBMM01008445    KMQ88871.1    GEHC01000964    JAV46681.1    LBMM01013668    KMQ85535.1    GALA01000302    JAA94550.1    ABLF02004597    ABLF02041324    AJ278684    CAB99192.1    GGFJ01001453    MBW50594.1    GALA01001776    JAA93076.1    GGFJ01001454    MBW50595.1    AAZX01001144    GFTR01008427    JAW07999.1    HACL01000281    CFW94575.1    ABLF02011927    AB090813    BAC57902.1    GGMR01009778    MBY22397.1    GGFL01001192    MBW65370.1    AB593323    BAK38643.1    ABLF02011136    ABLF02014426    ABLF02020969    ABLF02009709    ABLF02009711    M93691    AAA29365.1    AB090816    BAC57908.1    AB090817    BAC57910.1    ABLF02009073    ABLF02030702    ABLF02042963    GAKP01002292    JAC56660.1    ABLF02030663    ABLF02041312    GGFL01001916    MBW66094.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF00098   zf-CCHC
PF13966   zf-RVT
PF13359   DDE_Tnp_4
PF12017   Tnp_P_element
PF00075   RNase_H
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR026960   RVT-Znf       
IPR021896   Transposase_37       
IPR027806   HARBI1_dom       
IPR012337   RNaseH-like_sf       
IPR002156   RNaseH_domain       
IPR036397   RNaseH_sf       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
SSF53098   SSF53098       
Gene 3D
PDB
6AR3     E-value=2.47912e-05,     Score=116

Ontologies

Topology

Length:
671
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.19435
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00030
outside
1  -  671
 
 

Population Genetic Test Statistics

Pi
4.528473
Theta
4.501775
Tajima's D
0
CLR
0.207815
CSRT
0.389080545972701
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号