SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15026
Annotation
reverse_transcriptase_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.761
 

Sequence

CDS
ATGGTAGTGCAAGGCAGAGGGGGAAGAGGTCGACCGAATAAGACATGGATGGAGTGTGTGAATGACGATATGAGAGAGAGAGAGGATTGTTGGAAACCAGTGCTATCACATTCAACTGCTCACTTTCAGAATCTGGTCCCTCGTTTGTTGGGGGTGGCCGGCGCGTTAAGCCGGCTCCTTCCCAATGTCGGGGGGCCTGACCAGGTGACGCGCCGTCTCTATACAGGGGTGGTGCGATCAATGGCCCTATACGGGGCGCCCGTGTGGGGCCAGTCCCTGGCCGTGGGGGTAGCGAAGCTGCTGCAACGGCCGCAACGCACCATCGCGGTCAGGGTCATCCGTGGTTATCGCACCATCTCTTTCGAGGCGGCGTGTGTACTGGCTGGGACGCCGCCTTGGGTCCTGGAGGCGGAGGCGCTCGCTGCTGACTATCAGTGGCGGGCTGACCTTCGTATCCGGGGCGTGGCACGTCCCAGCCCCAGTGTGGTCAGAGCGCGGAGGGCCCAATCTCGGCGGTCCGTGCTGGAGGCATGGTCCAGACGGCTGGCCGATCCTTCGGCTGGTCGTAGGACCGTCGAGGCGATTCGCCCGGTCCTTGTGGATTGGGTGAATCGTGACAGAGGACGCCTCACTTTCCGGCTCACGCAGGTGCTCACTGGGCATGGTTGCTTCGGTGAGTTCCTGCACCGGATCGGAGCCGAGCCGACGGCAGAGTGCCACCATTGTGGTTGCGGCTTGGACACGGCGGAGCACACGCTCGTCGCCTGCCCCGCATGGGAGGGGTGGCGCCGTGTCCTCGTCGCAAAAATAGGAAACGACTTGTCGTTGCCGAGTGTTTTTGGAGTCGTCGTGGCCTAA
Protein
MVVQGRGGRGRPNKTWMECVNDDMREREDCWKPVLSHSTAHFQNLVPRLLGVAGALSRLLPNVGGPDQVTRRLYTGVVRSMALYGAPVWGQSLAVGVAKLLQRPQRTIAVRVIRGYRTISFEAACVLAGTPPWVLEAEALAADYQWRADLRIRGVARPSPSVVRARRAQSRRSVLEAWSRRLADPSAGRRTVEAIRPVLVDWVNRDRGRLTFRLTQVLTGHGCFGEFLHRIGAEPTAECHHCGCGLDTAEHTLVACPAWEGWRRVLVAKIGNDLSLPSVFGVVVA

Summary

EMBL
AB126050    BAD86650.1    AB090825    BAC57926.1    KZ150386    PZC71062.1    + More
KZ150308    PZC71477.1    KZ149950    PZC76665.1    AB078935    BAC06462.1    AB078930    BAC06454.1    AB078931    BAC06456.1    AB078929    BAC06452.1    KZ149896    PZC78733.1    RSAL01000481    RVE41577.1    D85594    BAA19776.1    LBMM01012027    KMQ86470.1    LBMM01014132    KMQ85305.1    LBMM01008861    KMQ88580.1    LBMM01009494    KMQ88097.1    KQ460685    KPJ12887.1    LBMM01012957    LBMM01012956    KMQ85900.1    KMQ85901.1    LBMM01003679    KMQ93242.1    KQ414641    KOC66782.1    ODYU01009945    SOQ54696.1    LBMM01006671    KMQ90407.1    QOIP01000010    RLU18098.1    LBMM01006110    KMQ90925.1    LBMM01005733    KMQ91252.1    LBMM01019838    KMQ83439.1    LBMM01019839    KMQ83438.1    LBMM01006954    KMQ90166.1    LBMM01006657    KMQ90417.1    LBMM01005707    KMQ91279.1    LBMM01008682    KMQ88705.1    LBMM01005634    KMQ91349.1    LBMM01006909    KMQ90209.1    GGMR01006442    MBY19061.1    GGMR01016864    MBY29483.1    LBMM01024024    KMQ82631.1    QOIP01000007    RLU20280.1    QOIP01000031    RLU14697.1    LBMM01004272    KMQ92618.1    LBMM01004634    KMQ92224.1    LBMM01006063    KMQ90967.1    LBMM01014909    KMQ85000.1    LBMM01015018    KMQ84954.1    LBMM01002052    KMQ95336.1    LBMM01007036    KMQ90099.1    LBMM01009738    KMQ87908.1    GGMR01015354    MBY27973.1    LBMM01015025    KMQ84953.1    GL437417    EFN70484.1    LBMM01008349    KMQ88951.1    LBMM01007425    KMQ89740.1    ABLF02026677    ABLF02032994    ABLF02059021    ABLF02064578    ABLF02005203    ABLF02041316    GFXV01001748    MBW13553.1    GGMR01019609    MBY32228.1    LBMM01020849    KMQ83202.1    LBMM01006640    KMQ90440.1    LBMM01006725    KMQ90373.1    LBMM01005216    KMQ91703.1    LBMM01012595    KMQ86127.1    LBMM01004505    KMQ92346.1    LBMM01007659    KMQ89538.1    ABLF02004597    ABLF02041324    ABLF02041886    LBMM01006287    KMQ90731.1    GFXV01003903    MBW15708.1    GGMS01012744    MBY81947.1    ABLF02004854    ABLF02041317    LBMM01003245    KMQ93755.1    LBMM01011877    KMQ86578.1    ABLF02011238    LBMM01008448    KMQ88867.1    ABLF02015311    ABLF02015320    ABLF02034009    ABLF02043484    LBMM01014294    KMQ85237.1    LBMM01021647    KMQ83033.1    LBMM01003988    KMQ92922.1    GGMR01005740    MBY18359.1    GGMR01012534    MBY25153.1    GGMR01011974    MBY24593.1    GGMR01012877    MBY25496.1    GGMR01006964    MBY19583.1    GGMR01014918    MBY27537.1    ABLF02016099    ABLF02041594    GGMR01000779    MBY13398.1    GAPW01001826    JAC11772.1    ABLF02016435    ABLF02016436    ABLF02064751    AB593326    BAK38647.1    GGMR01015159    MBY27778.1    KQ972691    KXZ75805.1   
Pfam
PF14529   Exo_endo_phos_2        + More
PF00078   RVT_1
PF01553   Acyltransferase
PF07776   zf-AD
PF00096   zf-C2H2
PF03372   Exo_endo_phos
PF17919   RT_RNaseH_2
PF00098   zf-CCHC
PF13843   DDE_Tnp_1_7
PF05699   Dimer_Tnp_hAT
Interpro
IPR000477   RT_dom        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR005135   Endo/exonuclease/phosphatase       
IPR002123   Plipid/glycerol_acylTrfase       
IPR012934   Znf_AD       
IPR013087   Znf_C2H2_type       
IPR036236   Znf_C2H2_sf       
IPR001878   Znf_CCHC       
IPR036875   Znf_CCHC_sf       
IPR041577   RT_RNaseH_2       
IPR029526   PGBD       
IPR037220   BED_dom       
IPR012337   RNaseH-like_sf       
IPR008906   HATC_C_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57667   SSF57667       
SSF57756   SSF57756       
SSF53098   SSF53098       
SSF140996   SSF140996       
Gene 3D

Ontologies

Topology

Length:
285
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.996390000000001
Exp number, first 60 AAs:
0.01335
Total prob of N-in:
0.06786
outside
1  -  285
 
 

Population Genetic Test Statistics

Pi
57.39989
Theta
49.840148
Tajima's D
-0.750128
CLR
69.61988
CSRT
0.184040797960102
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号