SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15009
Annotation
endonuclease-reverse_transcriptase_[Bombyx_mori]
Location in the cell
Nuclear   Reliability : 2.685
 

Sequence

CDS
ATGATTGCACACCGCAGAACCAGGCCCCTAGTCCCCGGCGGCCCCGCTATTCCTGGTTACGGTAGCGGCCATGGTAACGGCGGGGCAAGGGGTGCTAAGAATCCCCGGCAGAGATCCGGCTACCACCCCCCTTCACAACGACAACTGGCCCTGGTAACATACAACGTGCGCACTTTGAGGTTGGACGAGAAGCTAATAGAGCTGGAAGAAGAAATGAGCAAGTTGCGCTGGGACGTTATTGGTTTATCGGAGATCCGAAGAGAGGGGAGGATACGAAAACCTTACAGTCCGGCCACTTGTTCTACTACCGGGAGGGAGAACAGAAGTCCCAAGGTATACGCCCCATCGACGTCACATCCAGACGATGAAGTGGAAGCTACGTATGAGGACATTAGTAGAGCCATACGTAGCTCCCAATCACATTTTACCGTTGTTATGGGAGATTTCAATGCAAAACTGGGCCGTAGAGGCGATGATGAGTTGAAAGTGGGGCCATTTGGATTTGGGCAGCGGAATCCCAGAGGACAGATGCTGGCGGACTTTATGGAGAAGGAAGGACTCTTTATGATGAATTCTTTCTTCAAGAAGCCGCCACAACGGAGATGGACCTGGTTGAGTCCCGGCGGTGTAACAAGAAATGAAATTGACTTCATCATGAGCACCAACAGACAGATATTCAACGATGTCTCTGTGATCAACAGTGTAAAAACAGGAAGTGATCACCGAATCATCAGAGGCATGTTGAATATCAATGTCAGACTGGAAAGATCGCGTCTGATGAAGTCAACGCTTCGACCGTCGAATGCACAAATCCAAAACCCCGAGAGCTTTCAACTCGAATTGGCTAATCGCTTCGAATGGCTAAACAGCTGCGCATCAGTGGACGATGTAAACAGCAGCCTGGTAGAGACTGTCCGTACAGTAGGGTCCAAATTTTTCAAAACCCACCGTAAGAATAGACCTCAGAAACTATCCGACCGCACCCGAAACCTCATGGCTAGTCGACGTTTGATGACGCTCCAAACTTCGGAGGACGCTGAGTCATATAGGCAACTCAATAGACATATCATGAGGTCCTTGCGACACGATCTACGCTCCTTTAATACTCAGCGTATTAAAGAGACGATTGAGCGAAACCAAGGCTCTAAAGTGTTCGCAAGAGACGCTTCTATTGGGCAAAGCCAGCTGACGAAGCTGAAGACCGAAGATGGACATGTAACGTCGAATAAGTCAGAGGTCCTGCGGGAGATAGAGAGGTTCTGCGGGCAGCTGTTTACCTCGGTCTCAGCTGAACCGCAAGGTTTAGCTGCAGACCCTAGAGCCAAGCTAACCCGACACTACACCGAAGACATCCCGGACATCAGCCTGTACGAGATTAGGATGGCTCTCAAACAGCTTAAGAATAACAAGGCACCGGGCGAGGATGGAATTACTACGGAGCTTCTGAAAGCGGGCGGGACGCCGGTACTGAAAGTCCTTCAGAAGCTCTTCAATTCCTCTTTGCTCGATGGAAAACCGCCACAGGCATGGAGCAGGGGTGTTGTGATCCTGTTCTTCAAAAAAGGTGACAAAACCTTATTGAAGAACTATAGGCCCATAGCACTGCTGAGCCATGTCTACAAGCTGTTCTCGAGAGTCATCACGAAGCGTCTCGAACGCAGGTTTGATGACTTCCAGCCTACCGAACAAGCCGGTTTCCGAAAAGGCTACAGTACCATAGACCACATACATACGCTGCGGCAGATTGCACAGAAGACCGAAGAGTACAATCGGCCATTATGCTTAGCGTTTGTGGACTATGAGAAAGCCTTTGATTCCGTCGAAACATGGGCAGTCCTTAGATCTCTCCAGCGGTGCGGTATTGACCACCGGTACATCGAAGTATTGAAGTGTTTGTATAATAACGCCACCATGTCAGTCCGAGTACAGGAGCATTGCACGAAGGAAATCCCTGTAAAGAGAAGAGTGAGACAGGGAGATGTGATATCTCCGAAACTGTTTATCACTGCTCTGGAGGATTCCTTCAAGCTTCTGGAATGGCAAGGTCTTGGCATCAATATTAACGGCGAATACATCACTCATCTTCGGTTTGCCGATGACATCGTGGTCATGGCAGAGTCGCTGGAAGATTTAGAGCGTATGCTCGGTGACCTCAGTAGGGTTTCTCAACAAGTGGGTCTTAAAATGAACATGGACAAAACAACAATCATGTACAATGTCCATGTTGCACCCACCATAGTTACTGTTGGGAGTTCTACTCTTGAAGTTGTTGACGAATATATATACCTAGGACAGGCAGTCCGATTAGGTAGGTCCAACTTTGAGAGAGAGGTCAGTAGACGGATCCAACTCGGCTGGGCAGCGTTCGGTAAACTGCACAACGTCTTCTCGTCCAAAATACCTCAGTGCCTTAAGACAAAGGCGTACAACCAATGTGTGTTACCAGTGATGACTTACGGCTCGGAGACGTGGTGCTTCACTAGGGATCTTTTTAGAAGGCTCAAAGTCGCGTAG
Protein
MIAHRRTRPLVPGGPAIPGYGSGHGNGGARGAKNPRQRSGYHPPSQRQLALVTYNVRTLRLDEKLIELEEEMSKLRWDVIGLSEIRREGRIRKPYSPATCSTTGRENRSPKVYAPSTSHPDDEVEATYEDISRAIRSSQSHFTVVMGDFNAKLGRRGDDELKVGPFGFGQRNPRGQMLADFMEKEGLFMMNSFFKKPPQRRWTWLSPGGVTRNEIDFIMSTNRQIFNDVSVINSVKTGSDHRIIRGMLNINVRLERSRLMKSTLRPSNAQIQNPESFQLELANRFEWLNSCASVDDVNSSLVETVRTVGSKFFKTHRKNRPQKLSDRTRNLMASRRLMTLQTSEDAESYRQLNRHIMRSLRHDLRSFNTQRIKETIERNQGSKVFARDASIGQSQLTKLKTEDGHVTSNKSEVLREIERFCGQLFTSVSAEPQGLAADPRAKLTRHYTEDIPDISLYEIRMALKQLKNNKAPGEDGITTELLKAGGTPVLKVLQKLFNSSLLDGKPPQAWSRGVVILFFKKGDKTLLKNYRPIALLSHVYKLFSRVITKRLERRFDDFQPTEQAGFRKGYSTIDHIHTLRQIAQKTEEYNRPLCLAFVDYEKAFDSVETWAVLRSLQRCGIDHRYIEVLKCLYNNATMSVRVQEHCTKEIPVKRRVRQGDVISPKLFITALEDSFKLLEWQGLGININGEYITHLRFADDIVVMAESLEDLERMLGDLSRVSQQVGLKMNMDKTTIMYNVHVAPTIVTVGSSTLEVVDEYIYLGQAVRLGRSNFEREVSRRIQLGWAAFGKLHNVFSSKIPQCLKTKAYNQCVLPVMTYGSETWCFTRDLFRRLKVA

Summary

EMBL
FJ265543    ADI61811.1    FJ265544    ADI61812.1    FJ265549    ADI61817.1    + More
FJ265542    ADI61810.1    FJ265550    ADI61818.1    FJ265545    ADI61813.1    FJ265551    ADI61819.1    RSAL01001818    RVE40675.1    ODYU01004088    SOQ43598.1    KZ149907    PZC78256.1    MRZV01002136    PIK34564.1    FJ265562    ADI61830.1    JARK01001351    EYC23458.1    GBBI01004877    JAC13835.1    JARK01001354    EYC21713.1    JARK01001655    EYB84321.1    EYC21986.1    FJ265561    ADI61829.1    GDKW01001596    JAI54999.1    JARK01001565    EYB89683.1    JARK01001676    JARK01001446    JARK01001433    EYB83199.1    EYC01126.1    EYC02928.1    JARK01001337    EYC34625.1    FJ265564    ADI61832.1    DS268444    EFP01729.1    DS268591    EFO92565.1    GBGD01000453    JAC88436.1    JARK01001531    EYB92324.1    JARK01001621    EYB86109.1    JARK01001340    EYC30828.1    JARK01001626    EYB85833.1    JARK01001389    EYC11015.1    JARK01001581    EYB88505.1    JARK01000460    EYC36749.1    JARK01001435    EYC02496.1    JARK01001639    EYB85201.1    JARK01001500    JARK01001343    EYB95040.1    EYC28825.1    JARK01000302    EYC38674.1    JARK01001346    EYC26445.1    JARK01000109    EYC42952.1    JARK01001568    EYB89432.1    JARK01001711    EYB81734.1    GBBI01004876    JAC13836.1    JARK01001421    EYC04912.1    JARK01001359    EYC20105.1    JARK01000008    EYC46079.1    JARK01001338    EYC33297.1    JARK01000132    EYC42415.1    EYC30744.1    FJ265563    ADI61831.1    JARK01001497    EYB95322.1    ODYU01008249    SOQ51673.1    EYC10874.1    JARK01001475    EYB97550.1    JARK01001628    JARK01001583    JARK01001528    JARK01001506    JARK01001470    JARK01001467    JARK01001463    JARK01001457    JARK01001432    JARK01001420    JARK01001403    JARK01001371    JARK01001369    JARK01001360    JARK01001353    JARK01001349    JARK01000603    JARK01000080    EYB85741.1    EYB88438.1    EYB92544.1    EYB94540.1    EYB98080.1    EYB98468.1    EYB98899.1    EYB99568.1    EYC03088.1    EYC05014.1    EYC08153.1    EYC15852.1    EYC16408.1    EYC19456.1    EYC22445.1    EYC24734.1    EYC24778.1    EYC24866.1    EYC33488.1    EYC35672.1    EYC43798.1    JARK01000063    EYC44387.1    JARK01001344    EYC28216.1    JARK01001357    EYC20551.1    JARK01001401    EYC08686.1    JARK01001372    EYC15614.1    JARK01000161    EYC41641.1    JARK01001700    JARK01001393    EYB82228.1    EYC10181.1    JARK01001407    EYC07212.1    EYB95049.1    JARK01000173    EYC41342.1    JARK01001524    EYB92970.1    JARK01001612    EYB86585.1    JARK01001730    EYB81048.1    JARK01001637    EYB85284.1    EYB85282.1    JARK01000388    EYC37469.1    EYC03125.1    JARK01001582    EYB88498.1    JARK01001618    EYB86258.1    JARK01001370    EYC16150.1    JARK01001502    EYB94855.1    JARK01000802    EYC34990.1    JARK01001462    EYB98944.1    JARK01000204    EYB98082.1    EYC40602.1    EYB98081.1    EYC40601.1    JARK01001543    EYB91356.1    EYB85285.1    JARK01000177    EYC41210.1    JARK01000146    EYC42042.1    EYC41209.1    JARK01000347    EYC38051.1   
Pfam
PF00078   RVT_1        + More
PF14529   Exo_endo_phos_2
PF03372   Exo_endo_phos
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR036691   Endo/exonu/phosph_ase_sf       
IPR000477   RT_dom       
IPR016186   C-type_lectin-like/link_sf       
IPR016187   CTDL_fold       
SUPFAM
SSF56219   SSF56219        + More
SSF56436   SSF56436       
Gene 3D
PDB
6AR3     E-value=4.75953e-06,     Score=123

Ontologies

Topology

Length:
837
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.05593
Exp number, first 60 AAs:
0.00223
Total prob of N-in:
0.00026
outside
1  -  837
 
 

Population Genetic Test Statistics

Pi
458.427795
Theta
196.02821
Tajima's D
4.118014
CLR
0.144434
CSRT
0.9994000299985
Interpretation
Possibly Balancing Selection

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号