SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO15002  Validated by peptides from experiments
Pre Gene Modal
BGIBMGA004873
Annotation
PREDICTED:_polyribonucleotide_nucleotidyltransferase_1?_mitochondrial_[Amyelois_transitella]
Location in the cell
Mitochondrial   Reliability : 3.431
 

Sequence

CDS
ATGTTACATAAAAAATGTATATTATTAACAAAATTGAAGACGAAAAGTCGGTATTACTGTAGATTTCTCTCATCACAAGCCAAACTTGGCGTAATTGATATTCCTTTTACTAACGGGACCACCCTGAAATTGTCCACGGGCCGTTACGCAAGATTCGCAGATGGAGCATGTGTTGTGTCCCTCGGTAACACAAGCGTGCTATCAACTGTTGTGTCAAAAGCTAAACAAAATCCCACTTCGTTCTTACCACTCACAGTTGACTACAGACAAAAAGCCGCAGCCGCAGGACGAATTCCTACCAATTTTTTTAGGAGAGAACTGGGTCCATCAGAAAAAGAAATTCTTACTTCACGAGTAATAGATCGTTCCCTACGTCCGCTCTTCCCGAATAACTACAACTATGATACACAGATAGTATGCAACATGTTGGCGATGGATGGAACGAATTTGCCTGAAACAGTAGCTATAAATGCGGCAAGTGCAGCACTTGCACTTTCCGATGTGCCGTGGAATGGCCCTGTTGGTGCTGTTCGATTAGGTCAAATTGACAATGAATTAATAATAAATCCAACACGTAAAGAATTGGAGAAGTCTGTTTTGAACTTAATCGTGACAGCTACCAGCAGTAATCTAGTAGTGATGCTGGAAGGTAGCGCCTCCGACATCCTACAGCAGGATCTACTCAAGGCCATCAAATTAGGAACCAAAGAAGCTCAACAAATTGTGAGAGGGATAGAGAAACTGCAGAAGGATCATGGTAAAATGAAAAGAGAATATGAAATTCAACCACCTCTAGAACAAAACATTGTTGATACTATCAAAATATTATCTTCTATGAAAATCAGAGAAATATTGAGTGACTTCACCCACGATAAGACGTCCCGGGATAACGCCATATCCGATCTACGACAGACCGTGCTGAACCAGTTCCGGGACACGAACATAGACGTGACCCGTCTCCAGGACTGCTTCAACGAGAACCTCAAGCAGATATTCCGCGAGATGATCTTCGAGACTGACACGAGATGCGACGGCCGGCATCTTGATCAGCTCAGAGATATTAGCTGCCAGGTGTCGCTGTACGAGCCGCTCCACGGCAGCGCGGTGTTCCAGCGCGGACAGACGCAGGTGCTGTGCACCGTCGCCTTCGACTCGCCCGACAGCGCGCTCAGGGTGGACACGCTCACCATGCTCACCAGCGGAATCAAAGAGAAAAGTTTCTTCCTGCACTACGAATTCCCGCCATACGCAACCGGCGAGGTGGGTCGCACCGGAGCCCCAGGGCGCCGCGAGGCCGGCCACGGAGCCCTGGCCGAGCGGGGGCTGCTGCCCGTCGTGCCGCAACTACCCTACACCGTCAGACTTACAGCTGAAGTCTTAGAATCGAATGGATCGAGTTCGATGGCATCGGTGTGCGGGGGGTCGCTGGCCCTCATGGACGCGGGGGTGCCGCTGGGGGGGCCGGCCGCGGGGGTCGCCGTGGGGCTCGTCTCTAAAGCCGACGAGAACGGTCACATGGCCGACTACAGGATACTCACTGATTTGTTAGGCATAGAAGACTACATGGGCGATATGGACTTCAAAGTGGCCGGCACGAAGAAGGGCATCACGGCGCTGCAGGCGGACATCAAGCTGGCCGGCCTGCCGCTCCGCGTCGTCATGGAGGCCGTGCAGCGGGCTTGCGACGCCAAGGCCAAGATCATCGACATCATGAACCAATGCCTCGACGCACCCAGACAAGGATTAAAAGAGAACATGCCAGTGATTGAAGAGATCGAAGTGGAAGCTCACAAGCGGCCCAAGCTCCACGGGCTCGGCGGCTCCAACTTGAAGAAGCTTTACGTTGAGACCGGCGTGCAGGTGACGCCAGTGGACGAGACTAAGTACAGCGTGTTCGCGCCCTCCCGGCCCGCCATGGACGAGGCCCGCTCGCGTATGGCCTCCTGGCTCACCTCCGAGCGGACCCCAGAGCTGGAGTTCGGGGCCATATACAAGGCCAGAGTGGTCGAGGTCCGGGACATCGGCGTGCTGGTCACGCTGTACCCAGGAATGAGTCCGGCTTTAGTGCACAACACGCAGCTGGACCACAGGAAGATAATGCACCCCTCGGTTCTGGGGCTGGAAGTCGGCTCGGAGATCCAGGTGAAGTACTTCGGGCGGGACCCCGTGTCGGGGCAGGTCCGCTTGTCCAAGAAAGTGCTATCGTCGCCGCCGCCCGCCGTCGTCAGGAATTTGGATAAAAGTTAG
Protein
MLHKKCILLTKLKTKSRYYCRFLSSQAKLGVIDIPFTNGTTLKLSTGRYARFADGACVVSLGNTSVLSTVVSKAKQNPTSFLPLTVDYRQKAAAAGRIPTNFFRRELGPSEKEILTSRVIDRSLRPLFPNNYNYDTQIVCNMLAMDGTNLPETVAINAASAALALSDVPWNGPVGAVRLGQIDNELIINPTRKELEKSVLNLIVTATSSNLVVMLEGSASDILQQDLLKAIKLGTKEAQQIVRGIEKLQKDHGKMKREYEIQPPLEQNIVDTIKILSSMKIREILSDFTHDKTSRDNAISDLRQTVLNQFRDTNIDVTRLQDCFNENLKQIFREMIFETDTRCDGRHLDQLRDISCQVSLYEPLHGSAVFQRGQTQVLCTVAFDSPDSALRVDTLTMLTSGIKEKSFFLHYEFPPYATGEVGRTGAPGRREAGHGALAERGLLPVVPQLPYTVRLTAEVLESNGSSSMASVCGGSLALMDAGVPLGGPAAGVAVGLVSKADENGHMADYRILTDLLGIEDYMGDMDFKVAGTKKGITALQADIKLAGLPLRVVMEAVQRACDAKAKIIDIMNQCLDAPRQGLKENMPVIEEIEVEAHKRPKLHGLGGSNLKKLYVETGVQVTPVDETKYSVFAPSRPAMDEARSRMASWLTSERTPELEFGAIYKARVVEVRDIGVLVTLYPGMSPALVHNTQLDHRKIMHPSVLGLEVGSEIQVKYFGRDPVSGQVRLSKKVLSSPPPAVVRNLDKS

Summary

EMBL
ODYU01009033    SOQ53144.1    NWSH01000577    PCG75543.1    AGBW02000220    OWR55807.1    + More
KQ971351    EFA06447.1    KK853697    KDQ96253.1    APGK01045628    KB741037    KB632319    ENN74666.1    ERL92290.1    GECZ01012206    JAS57563.1    UFQT01000509    SSX24854.1    GDIP01050745    LRGB01000704    JAM52970.1    KZS16503.1    GDIP01159182    JAJ64220.1    GDIP01015966    JAM87749.1    GDIQ01220148    JAK31577.1    GDIP01217174    JAJ06228.1    NNAY01003564    OXU19193.1    AXCN02001805    ATLV01005272    ATLV01005273    KE524276    KFB35183.1    AJVK01033652    GEDC01017707    JAS19591.1    GEZM01036371    JAV82756.1    GBYB01002334    GBYB01013191    GBYB01013194    JAG72101.1    JAG82958.1    JAG82961.1    APCN01003489    LBMM01004732    KMQ92126.1    QOIP01000007    RLU20809.1    GL732546    EFX80827.1    GDHF01002545    JAI49769.1    GFDL01013561    JAV21484.1    AAAB01008979    EAA13718.3    ADMH02001521    ETN62205.1    AJWK01015482    GGLE01000358    MBY04484.1    GDIP01212721    JAJ10681.1    CH477203    EAT48007.1    GFJQ02001037    JAW05933.1    GAKP01017333    JAC41619.1    ADTU01020396    GFWV01023145    MAA47872.1    CH902617    EDV42052.1    CH954182    EDV52955.1    JXUM01100204    JXUM01100205    KQ564550    KXJ72097.1    KQ982701    KYQ51926.1    CM000364    EDX15122.1    AE014297    BT149874    AAF57151.2    AAN14273.1    ABW08815.2    ACZ95076.1    AFY63573.1    CM000160    EDW99221.1    KRK04733.1    BT015961    AAV36846.1    GDIQ01253829    JAJ97895.1    GGMS01003672    MBY72875.1    CH933806    EDW16490.1    CP012526    ALC47841.1    CH940650    EDW67742.1    CH916373    EDV94515.1    GFXV01000985    MBW12790.1    OUUW01000005    SPP81135.1    CM000070    EAL27082.1    CH479198    EDW27955.1    GAMC01015518    JAB91037.1    KQ976507    KYM82807.1    GEFM01002883    JAP72913.1    ABLF02031973    AY061061    AAL28609.1    GANP01004130    JAB80338.1    JO842301    AEO33918.1    GBHO01044672    GDHC01009054    JAF98931.1    JAQ09575.1    LNIX01000002    OXA59195.1    GFPF01010704    MAA21850.1    GEDV01005182    JAP83375.1    GBRD01006584    JAG59237.1    CVRI01000070    CRL07195.1    CH964251    EDW83255.1    GEFH01000410    JAP68171.1    GL437703    EFN70107.1    JRES01000007    KNC34911.1    JXJN01019747    KQ979602    KYN20516.1    KQ976750    KYN08710.1    CCAG010004370    JH431312    GL768105    EFZ12276.1    BDGG01000004    GAU98331.1    KK854443    PTY15892.1    HADZ01017124    HAEA01003958    SBQ32438.1   
Pfam
PF03726   PNPase        + More
PF03725   RNase_PH_C
PF01138   RNase_PH
PF00013   KH_1
PF00575   S1
PF13393   tRNA-synt_His
PF12745   HGTP_anticodon2
PF03088   Str_synth
Interpro
IPR015848   PNPase_PH_RNA-bd_bac/org-type        + More
IPR003029   S1_domain       
IPR020568   Ribosomal_S5_D2-typ_fold       
IPR036345   ExoRNase_PH_dom2_sf       
IPR012162   PNPase       
IPR012340   NA-bd_OB-fold       
IPR001247   ExoRNase_PH_dom1       
IPR015847   ExoRNase_PH_dom2       
IPR036612   KH_dom_type_1_sf       
IPR027408   PNPase/RNase_PH_dom_sf       
IPR004087   KH_dom       
IPR036456   PNPase_PH_RNA-bd_sf       
IPR004088   KH_dom_type_1       
IPR022967   S1_dom       
IPR036621   Anticodon-bd_dom_sf       
IPR041715   HisRS-like_core       
IPR024435   HisRS-related_dom       
IPR011042   6-blade_b-propeller_TolB-like       
IPR018119   Strictosidine_synth_cons-reg       
SUPFAM
SSF55666   SSF55666        + More
SSF54211   SSF54211       
SSF54791   SSF54791       
SSF50249   SSF50249       
SSF46915   SSF46915       
PDB
5ZF6     E-value=0,     Score=1646

Ontologies

Topology

Length:
748
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.23394
Exp number, first 60 AAs:
0.09512
Total prob of N-in:
0.00732
outside
1  -  748
 
 

Population Genetic Test Statistics

Pi
245.583652
Theta
168.919681
Tajima's D
1.083579
CLR
1.885112
CSRT
0.68101594920254
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Peptides ×
Source Sequence Identity Evalue
28556443 LGQIDNELIINPTR 100.00 8e-04
28556443 LTELLK 100.00 0.006
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号