SGID Silkworm Genome Informatics Database
Gene
KWMTBOMO14980
Annotation
PREDICTED:_LOW_QUALITY_PROTEIN:_uncharacterized_protein_LOC105841899?_partial_[Bombyx_mori]
Location in the cell
Mitochondrial   Reliability : 1.897
 

Sequence

CDS
ATGGAAGCACTTAATTACACTCTGACTATCGGAGCACAAGTCACCGGCCAGCGTGAGACGCAGAAGACTGCTCCTGCCCCGTCCCAGCCTCCGAAGGCGGGGCCCGGCAGGAGCCGGACCAAGAAGAAGGGGCGGACCAATGCAGCCAAACCGGCACCGACCCCCCAGCCCCGCCCACTGCCCCCGGCCCCGGTAAACATGAACGAGGCCTGGACGACAGTGGTGCGGCGAGGGCCCAAAAAGGTGGCGGCGCCTCCTGCGCCGCGCCCCAAGCCCGCCCCTGCGGCCGCCGCTCCCCGCCAAGAGGGTCGAGCGGAGCCGAGGGGCCGAACTGGAAGAAGGAGGCCGCGCGCCCCGCGGTCGGCTGCAGTGGTAGTGGAGCTGCTGCCGGCCGGCAAAGAAAAGGGCATCACCTACCACGAGGTGATGACCCAGGCGCGCGGCGGCGTGAATGTGGACGCCCTCGGCGTGGAGGGGGGCATCAAGGTCCGGCAGACGGCCAACGGGGCTCGTCTTATAGAGTGCCCCGGCCCCAACACAAACGCCGCGGCCGAAAAATTGGCGGCCCGGCTGAGGGAGATCCTGCCGGACCCCGAGGTGGTGCGCATCGCGCGGCCCGTGAAGATGGGAGAAGTAAAAATCACGGGCCTCGACGAGTGCGCCACGAAAGAGGAGGTCGCCGCGGCCATCGCGTCGCAGGGCAACTGCGCCCTCGCCGACGTCAAAGTCGGAGAGCTCCGGGTGACATATTCCGGAACCCGGACGGCGTGGGCGCGTTGCCCGATTGCAACGGCGACCCTCCTGGCCACCCCTCCACAGGGGCGGCCTTCCGACAGCCCAGGAAGGCTGCGCGTGGGCTGGGTAGTGGCCCACGTGCAACTGCAGGAGAGCAGGCCGTGGCGTTGTCTTCGGTGCTTCGGCACCGGCCACGGCCTCGCCAAGTGCCCCTCGACCGTGGACCGCAGCGACCTGTGTTTCCGCTGCGGCCAACCGGGACACAAGGCAGCCTCCTGCACCACAGCCGCGCCGCACTGCGTCTTGTGCGACGCGGCTAAAAGGAAGGCCGACCACCGGGCCGGGGGCCCGGCATGTAAATCCGCCCCCTCCTCTACCAAAACGAGGAGGGGCGGAAAGAAAAATAAAAAGAATAAGGAGAGGCCGGCTGCAACAAGGGCAGCCGGCGAGTCAGTTCCCGTCGCGGCTATTGTCGAGCCGCAGGGCGGGACAGACGAGGGAGCGATGGACGATCTCCTCGTCCACACCATGGCGGAGTGGTCAATCGACGTCGCTGTCGCCGCGGAGCCGTACTTCGTCCCCACCGACCAGGACTGCTGGATGGGGGACGTCGACGGCTCCGTGGCCATCGTACTAAGACAGTCCGCGGCGTTACCCCCCTTGGATATGGTGGCCAGGGGACCCGGGTGGGCCTTGAAACGAATGAACAAGGAGTTGCTGATGGAGGCGGCCGCTGTTGCTGCGTGGGCGCCAAAACCCGCGCGGCTCGCGGACGTGGATGCGGAGGTCGACTGGTTCCGGGGCACCATGGCAAACATTTGTGATGCCGCCATGCCCCGGGTCGGCCCCGAGCACCACGTGGGGACGGCGGCCCGGCTGCACGCTGACTGTCGTCAAAAGCAGACGGCGCTGCAGCTGGCCATCGGCGAGGCCAAGAAGCAGAGCATGAAGACTCTCCTGGAGTCGCTCGACGAAGATCCCTGGGGGCGCCCATACAAGATGGTTCGCAGGAAACTGCAGCCGTGGGCGCTCCCGGTGACCGAGCGGCTCCAGCCTCGGCAGCTGCGGGAAATAGTTTCTGCGCTTTTCCCGCCGGCAGCGGGGGGGGACTTTGAGCCCCCCCAGATGGACGCCACGTGGGGCACGCCTCCGCGTCGCCCCAGCGTTCCCGCTGCCGAGGAGCCCCCTCCCCCTATCACGGGGGCGGAGATCCATGCGGCCGTGTCCAAAATGAGAGCGAAGGACACGGCCCCCGGCCCTGACGGCGTTCACGGCCGGGTCTGGAGCTTGGCCTTCGAGGCCCTAGGGGACCGGCTCGGGGGGCTTTTCGAAGCGTGCCTCGAGTCGGGACGGTTCCCGTCGAAATGGAAGACGGGCAGACTGGTCCTTCTGCGGAAGGACGGGCGCCCCGCGGACTCACCCGCGGGCTATCGCCCCATCGTGTTGCTGGACGAAGCGGGCAAGATGCTCGAGAGGATCGTCGCGGCCCGCATCGTCCGGCACCTGACCGAGACGGGTCCCGATCTTTCGGCGGAGCAATACGGCTTCAGAGAGGGCCGCTCGACTATCGACGCAATTCTGCGCGTGCGGGCCCTCTCCGATGAAGCCGTATCCCGGGGCGGGGTGGCGATGGCGTTATCCTTAGATGTAAGGAACGCCTTCAACACCCTGCCCTGGTCGGTGATCGCGGGGGCGCTGGAGTATCACGGCGTCCCCGCATACCTCCGCCGACTGATCGGCTCCTATCTCGAGGGCAGGTCGATCCAGTGCATCGGACACGGTGGGGCGATGTACCGCTTCCCCGTCGAGCGCGGTGTTCCGCAGGGGTCCGTCCTGGGCCCCCTGCTGTGGAACATCGGCTACGACTGGGTCCTGCGGGGCGTCATTCGGGGACCCCTCCCCGGGCTGAGCGTAATCTGTTACGCCGACGACACGTTGGTCGTGGCTCCGGGGAGGGACTACCGGGAGTCTGCCCGTCTGGCGTGCGCAGGCGTGGCACACGTCGTCACTAGGATCCGACGGTTGGGGCTCGAGGTGGCGCTCGACAAAACCCAGGCCCTGATGTTTCACGGGCCGGGACGAGCGCCGCCTGTGGGTGCCCACCTCGTGATCGGAGGCGTCCGCGTCGGGGTCGGGGTGACCGGTCTTCGGTATCTCGGCCTCGAACTGGACGGTCGGTGGAACTTCCGCGCTCACTTTGAGAAGTTGGGCCCTCGGCTGATGGCAACGGCCGGCTCTTTGAGCCGGCTCCTTCCAAACGTCGGGGGTCCCGATCAGGTGGCGCGCCGCCTCTACATGGGGGTGGTGCGGTCGATGGCACTATACGGCGCGCCCGTATGGTGCCACGCCCTGACCCGCCAGAACGTCGCCGCGCTGCGACGTCCGCAGCGCGCGATCGCGGTCAGGGCGATCCGAGGATACCGCACCGTCTCCTTCGAGGCGGCGTGCTTGCTCGCCGGGGCGCCACCCTGGGACCTGGAGGCGGAGGCGCTCGCTGCCGATTACCGGTGGCGTAGCGACCTCCGCTCTAGGGGGGAAGGGCGCCCCGGCGAAGGAGTAGTTCGAGCGCGGAGGCTCCAATCTCGGCGGTCCGTGCTGGAGGCGTGGTCTCGCCGCTTGGCGGACCCGTCGGCCGGCCTCCGAACCGTCGAGGCGGTCCGCCCGGTTCTCGCGGACTGGGTGGGCCGCGACCGCGGATGCCTCACCTTCCGGCTAACGCAGATGCTTACCGGCCATGGTTGTTTCGGCCGGTACTTGCACAAGATAGCCGGAAGGGAACCGACGGCGCAGTGCCACCACTGCGCGGACCGCGACGAGGAAGACACAGCGGAACACACATTGGCGCGTTGTTCTGGATTTGACGAGCAACGCGCCGCCCTCGTCGCGGTCATAGGAGAGGACCTCTCGCTGCCGCGCGTCGTGGCTACGATGCTCGGCAGCGACGCGTCCTGGAAGGCGATGCTCGACTTCTGCGAGTCCACCATATCGCAGAAGGAGGCGGCGGAGCGAGAGAGGGAGAGCTCTTCCCTTTCCGCACCGATCCGTCGCCGTCGAGCCGGGGGCCGGAGGCGGGAATACGCCCGTACGTCCCGGCCCCTGTAG
Protein
MEALNYTLTIGAQVTGQRETQKTAPAPSQPPKAGPGRSRTKKKGRTNAAKPAPTPQPRPLPPAPVNMNEAWTTVVRRGPKKVAAPPAPRPKPAPAAAAPRQEGRAEPRGRTGRRRPRAPRSAAVVVELLPAGKEKGITYHEVMTQARGGVNVDALGVEGGIKVRQTANGARLIECPGPNTNAAAEKLAARLREILPDPEVVRIARPVKMGEVKITGLDECATKEEVAAAIASQGNCALADVKVGELRVTYSGTRTAWARCPIATATLLATPPQGRPSDSPGRLRVGWVVAHVQLQESRPWRCLRCFGTGHGLAKCPSTVDRSDLCFRCGQPGHKAASCTTAAPHCVLCDAAKRKADHRAGGPACKSAPSSTKTRRGGKKNKKNKERPAATRAAGESVPVAAIVEPQGGTDEGAMDDLLVHTMAEWSIDVAVAAEPYFVPTDQDCWMGDVDGSVAIVLRQSAALPPLDMVARGPGWALKRMNKELLMEAAAVAAWAPKPARLADVDAEVDWFRGTMANICDAAMPRVGPEHHVGTAARLHADCRQKQTALQLAIGEAKKQSMKTLLESLDEDPWGRPYKMVRRKLQPWALPVTERLQPRQLREIVSALFPPAAGGDFEPPQMDATWGTPPRRPSVPAAEEPPPPITGAEIHAAVSKMRAKDTAPGPDGVHGRVWSLAFEALGDRLGGLFEACLESGRFPSKWKTGRLVLLRKDGRPADSPAGYRPIVLLDEAGKMLERIVAARIVRHLTETGPDLSAEQYGFREGRSTIDAILRVRALSDEAVSRGGVAMALSLDVRNAFNTLPWSVIAGALEYHGVPAYLRRLIGSYLEGRSIQCIGHGGAMYRFPVERGVPQGSVLGPLLWNIGYDWVLRGVIRGPLPGLSVICYADDTLVVAPGRDYRESARLACAGVAHVVTRIRRLGLEVALDKTQALMFHGPGRAPPVGAHLVIGGVRVGVGVTGLRYLGLELDGRWNFRAHFEKLGPRLMATAGSLSRLLPNVGGPDQVARRLYMGVVRSMALYGAPVWCHALTRQNVAALRRPQRAIAVRAIRGYRTVSFEAACLLAGAPPWDLEAEALAADYRWRSDLRSRGEGRPGEGVVRARRLQSRRSVLEAWSRRLADPSAGLRTVEAVRPVLADWVGRDRGCLTFRLTQMLTGHGCFGRYLHKIAGREPTAQCHHCADRDEEDTAEHTLARCSGFDEQRAALVAVIGEDLSLPRVVATMLGSDASWKAMLDFCESTISQKEAAERERESSSLSAPIRRRRAGGRRREYARTSRPL

Summary

Pfam
PF14529   Exo_endo_phos_2        + More
PF00098   zf-CCHC
PF00078   RVT_1
Interpro
IPR005135   Endo/exonuclease/phosphatase        + More
IPR001878   Znf_CCHC       
IPR036691   Endo/exonu/phosph_ase_sf       
IPR036875   Znf_CCHC_sf       
IPR000477   RT_dom       
SUPFAM
SSF56219   SSF56219        + More
SSF57756   SSF57756       
Gene 3D
ProteinModelPortal
PDB
6AR3     E-value=0.000221473,     Score=111

Ontologies

Topology

Length:
1278
Number of predicted TMHs:
0
Exp number of AAs in TMHs:
0.17945
Exp number, first 60 AAs:
0
Total prob of N-in:
0.00003
outside
1  -  1278
 
 

Population Genetic Test Statistics

Pi
130.790966
Theta
124.409197
Tajima's D
0
CLR
0.221136
CSRT
0.370481475926204
Interpretation
Uncertain

Multiple alignment of Orthologues

 
 

Gene Tree

 
 
Copyright@ 2018-2023    Any Comments and suggestions mail to:zhuzl@cqu.edu.cn   渝ICP备19006517号